Gene & Genome

Gene & Genome margaret Wed, 11/16/2011 - 14:24

!2022 (Maresca)

!2022 (Maresca) kdorfman Fri, 06/03/2022 - 18:13

Tom Maresca's first run of G&GA

class day date topics
1 W 9/7 Tom: Intro to the course
Kate: intro to safety, fluorescence microscope
live cell imaging on conA coverslip dishes
2 M 9/12 pipetting, S2 culture, microscopy
3 W 9/14 Transformation
4 M 9/19 mini prep, pcr
5 W 9/21 0.9% gel, band extraction
6 M 9/26 invitro transcription kit; conA dishes
7 W 9/28 gel, + Nanodrop
8 M 10/3 ds RNA treatment
9 W 10/5 16 conA dishes (Tom)
5 mL S2 aliquots
10 W 10/12 immunostaining
11 M 10/17 repeat ds RNA treatment
make 1 conA coverslip per student
12 W 10/19 IF (students seed coverslips and fix) on control and dsRNA treated cells
13 M 10/24 looking at coverslips (Ctrl vs treated)
14 W 10/26 presentations (in ILC?)
15 M 10/31 transformations (PXGFP); STLC (dishes); splitting demo
16 W 11/02 Miniprep, nanodrop, restriction digest (Bsb1)
17 M 11/07 gel, gel extraction (1 per student), anneal primers (1 per Group), isothermal reaction, Transformation of Competent Cells
45 min gel rather than 60 min?
15 min, not 15 sec on thermocycler for isothermal rxn
split HeLas while gels run
18 W 11/09 mini prep, (skip nanodrop)
1 uL 30 min test digest (BsmB1)
45 min test gel
split cells during either digest or gel, depending on lecture
19 M 11/14 transfection of HeLa cells
20 W 11/16 look at cells, notice transformation efficiencies
21 M 11/21 immunostaining w/ Rabbit anti-K167 (Tom to bring - what concentration?)(red secondary) & Rat anti-alpha Tubulin (Green secondary)
22 M 11/28 nucleofect Guide 1 & Guide 2 (122), or just Guide 2 into WT HeLas.
DON'T USE gfp-tubulin HeLas for this
23 W 11/30 Checked transfections in cover-slip bottom dish. Nucleofection effiiency Nuc blue
24 M 12/5 IF for Ki67 tubulin and dapi.
seed glass bottom dish to view next meeting. treat cells with nocodazole at 10 am before class W
25 W 12/7 1st hour: live cell imaging of nocodazole treated cells1 with NucBlue
rest of class: work on posters
26 M 12/12 Poster presentations in ILC (RESERVE ROOM)

  1. Make 10 mL of 3.3 nocodazole. 3 hours before class, remove 1 mL DMEM from each dish, replace with 1 mL 3.3uM nocodazole, for a final concentration of ~1.75 uM. Give students 1 mL aliquots of fluorobrite with 1.75 uM nocodazole and 20 drops/10 mL nucblue. ↩︎

2022 prep plans
creating epitope for anti-Ki67

Annealed primers

Annealed primers kdorfman Mon, 11/07/2022 - 19:31

Annealed primers for CRISPR sgRNA primers

for isothermal reaction (Gibson assembly)

master stock is 2905.2 ng/uL

5 uL aliquots of 1 ng/uL

ConA dishes for 383H

ConA dishes for 383H kdorfman Wed, 09/21/2022 - 20:18

Materials:

  • con A aliquots

  • cleaned (but not necessarily sterile coverslip dishes (check size so they'll fit into the adaptors for the microscope stage)

  • 10 mL S2 medium in a conical tube

Protocol

  • Students put conA in non-sterile dishes

  • When they split their cultures, they put 1 mL of cells into a microfuge tube.

  • In class, they put cells onto the treated coverslip, then add medium after they are stuck.

Materials

Materials kdorfman Fri, 09/02/2022 - 20:58

W 9/7:

  • S2 media for us
  • plate cells 15-20 min before class
    • 1/2 Con A (Tom supplied 12 dishes)
    • 1/2 untreated

PCR (383H 2022)

PCR (383H 2022) kdorfman Thu, 09/15/2022 - 20:42

Reagents

100 uL reaction; 1 reaction per student

reagent uL per rxn uL aliquot for group of 3 to share
DNA template1 1 uL students use their own miniprep product
10 mM dNTPs 2 10
5X PFU buffer2 20 65
Primers3 20 mM 5 20
water (sterile) 66.5 250
Phusion Enzyme4 0.5 dispensed by instructor with a 2uL pipette

The PCR program is:

  1. 2 minutes at 95C
  2. 45 seconds at 95C (Denaturation)
  3. 45 seconds at 55C (Primer annealing)
  4. 30 seconds at 72C (Extension) (See manual below)
  5. Repeat steps 2-4 30X
  6. 10 minutes at 72C
  7. Forever at 4C

  1. Amount of DNA template may depend on final concentration of template DNA. If more than 1 ul of DNA needs to be used, reduce the amount of water in the reaction accordingly. Check concentrations with Nano-drop just to see that they got plasmid. ↩︎

  2. Use "HF Buffer" unless you have a difficult GC-rich template DNA. Then, you could change to the included "GC" Buffer. ↩︎

  3. KLP61 RNAi F: TAATACGACTCACTATAGGGTATTTGCGCATTATTTTAAAA
    KLP61 RNAi R: TAATACGACTCACTATAGGGATATTGATCAATTGAAAC
    stock is 500 mM ↩︎

  4. Fisher F530S Phusion High–Fidelity DNA Polymerase ↩︎

Maresca PCR Protocol
Phusion Manual

PCR 2024

PCR 2024 kdorfman Wed, 09/11/2024 - 22:17

Reagents

100 uL reaction; 1 reaction per student

reagent uL per rxn uL aliquot for group of 3 to share
DNA template1 1 uL students use their own miniprep product
10 mM dNTPs 2 10
5X Phusion buffer2 20 65
Primers3 20 mM 5 20
water (sterile) 66.5 250
Phusion Enzyme4 0.5 dispensed by instructor with a 2uL pipette

The PCR program5 is:

  1. 2 minutes at 95C
  2. 30 seconds at 95C (Denaturation)
  3. 30 seconds at 55C (Primer annealing)
  4. 30 seconds at 72C (Extension)6
  5. Repeat steps 2-4 30X
  6. 10 minutes at 72C
  7. Forever at 4C

  1. Amount of DNA template may depend on final concentration of template DNA. If more than 1 ul of DNA needs to be used, reduce the amount of water in the reaction accordingly. Check concentrations with Nano-drop just to see that they got plasmid. ↩︎

  2. Use "HF Buffer" unless you have a difficult GC-rich template DNA. Then, you could change to the included "GC" Buffer. ↩︎

  3. KLP61 RNAi F: TAATACGACTCACTATAGGGTATTTGCGCATTATTTTAAAA
    KLP61 RNAi R: TAATACGACTCACTATAGGGATATTGATCAATTGAAAC
    stock is 500 mM ↩︎

  4. Fisher F530S Phusion High–Fidelity DNA Polymerase; Switch to NEB M0530L ↩︎

  5. on Thermocycler 1, Folder G&GA, program G_GA2022 ↩︎

  6. Extension time rule of thumb for Phusion: 15-30 seconds per KB;
    Our product will be 500 bp, so we set extension to 30 sec ↩︎

2024 383 PCR
Phusion User Manual

Reagents

Reagents kdorfman Fri, 08/26/2022 - 17:06
Reagent for part # ordered? received?
1 M Tris HCl pH 7.5 Isothermal mix no on buffer shelf
1 M MgCl2 Isothermal mix no on buffer shelf
10 mM dNTP isothermal mix Fisher R9012 no in RT reagents box (-20)
1M DTT isothermal mix Acros 426380500 no in refrigerator door
Peg 8000 isothermal mix Fisher 04344322 yes above chem bench prep room
NAD isothermal mix MP Biomedicals 02100499.1 yes
T5 exonuclease PCR Fisher M0663S yes Maresca freezer box
Phusion polymerase PCR Fisher F530S yes Maresca freezer box -20
Taq ligase PCR NEB M0208L yes Maresca freezer box
SiR Tubulin microtubule stain Fisher NC0958386 yes Maresca freezer box -20
T7 RiboMAX Express RNAi System RNAi expts Promega PRP1700 yes Maresca freezer box
Heat inactivated FBS S2 culture Fisher 10082147 yes freezer -20
Anti-anti S2 culture Fisher F530S no tissue culture aliquots freezer box
S2 medium S2 culture Fisher 21720-24 ordered 4 above fridge in tissue culture room
ZR plasmid miniprep S2 transformation D4015 yes above bench in prep room
reagent list

T7 RiboMAX

T7 RiboMAX kdorfman Wed, 09/21/2022 - 19:46

Transcription mix

Students make the transcription mix from the kit

1 reaction per group

Reagent Sample reaction
RiboMAX™ Express T7 2X Buffer 10 µL
linear DNA template (1µg total) 1– 8µL
Nuclease-Free Water 0–7µl
Enzyme Mix, T7 Express 2 µL
Final Volume 20 µL
T7-riboMAX protocol

Transformation (G&GA 2022)

Transformation (G&GA 2022) kdorfman Thu, 09/15/2022 - 15:11

Protocol

1 reaction per group

  • 25 uL competent cells l^*] (get from Tom's lab, or NEB C2988J)
  • 1 uL plasmid Klp61F (10-50 ng) (in plasmids box in 362A freezer)
  • ice 5 minutes
  • heat shock 42C 30sec
  • ice, bring volume to 1 mL with LB
  • shake (200 rpm) at 37C 20-30 min
  • Plate 200 uL on LB-Amp
  • Make a second plate:
    • Spin down remaining 800 uL,
    • Resuspend in 200 uL
    • plate on LB-Amp
  • incubate 37C overnight
  • instructors take plates and start liquid cultures from them for the students
    • (2024) For each group, instructors take 3 colonies from transformation plates
    • Grow overnight in LB amp 5 mL aliquots (Thursday)
    • Pellet (Friday), remove supernate. Refrigerate pellet over weekend
    • Distribute pellets Plus miniprep reagents on Monday

Students need

  • 2 LB-Amp plates per pair

  • 1 mL LB per pair

  • sterile water

  • sterile beads

  • hot block at 42C

  • shaker at 37C, rigged with a slanted microfuge tube rack

  • plasmid Klp61F (do miniprep in advance if there is none in the plasmid box in 362A freezer

  • competent cells

  • markers

gel materials 383H F22

gel materials 383H F22 kdorfman Tue, 09/20/2022 - 14:20

0.9% agarose with sybr safe

TAE

Loading dye

Ladder

8 gel rigs, 8-well columns

blue light boxes, viewing shroud, orange filters

2022 (Arabidopsis)

2022 (Arabidopsis) kdorfman Wed, 12/22/2021 - 17:40

Planting schedule

Week Day Date Lab
1 W 1/26 0.1: Plant Col0 seeds (24 pots),
micropipetting
2 M 1/31 0.2: Benchling platform
1.1: Initial working maps
W 2/02 1.2: Finalizing gene models
3 M 2/07 1.3: Identifying T-DNA insertion sites
W 2/09 1.4: Designing primers
4 M 2/14 2.1: DNA extraction (plants from week 1)
Lab 1 report due
W 2/16 2.2: DNA quantification
5 Tu 2/22 4.1: BLAST
W 2/ 23 4.2: Literature search
6 M 2/28 2.3: Testing PCR conditions
W 3/02 0.3: Arabidopsis essentials (6 rose pots per table)
3.1: Salk like genetics
plant Salk seeds (48 pots)
Lab 2 report due
7 M 3/07 4.3: Phylogeny
W 3/09 Catch-up Day
SPRING BREAK
8 M 3/21 3.2: Phenotyping Salk mutants
W 3/23 5.1: Genotype Salk mutants (DNA extraction)
Lab 4 report due
9 M 3/28 5.2 Genotype Salk mutants (PCR)
W 3/30 5.3 Genotype Salk mutants (gel purification)
10 M 4/04 5.4: Sequence analysis
W 4/06 6.1: Gene expression resources
Lab 5 report due
11 M 4/11 6.2: Statistical analysis of gene expression data
W 4/13 6.3: q-RT-PCR planning (see Planting schedule for prep)
12 W 4/20 6.4: RNA extraction and quantification
13 M 4/25 6.5: RT and qPCR
W 4/27 catch-up day
Lab 3 report due
14 M 5/02 6.6: Analysis of qPCR data
W 5/04 Work on final presentation
Finals M 5/09 Lab 6 report due
W 5/11 Final presentation due
Last chance for make-ups
Extra credit due

2.1 DNA extraction 2022

2.1 DNA extraction 2022 kdorfman Thu, 02/10/2022 - 14:21

Here are the equipment & reagents

LN2, tongs and dewars

ball mill (pre-chill the blocks)

grinding tubes and steel balls

miracloth cut into squares

funnels

Compost pot

Stinky waste bucket in hood for Beta mercapto ethanol

Dirty pots dishpan

Reagent per rxn per pair per class
DNA extraction buffer 600 uL 1250 uL 16.25 mL
KOAc 5M </a. 250 uL 550 uL 7.150 mL
Isopropanol 600 uL 1200 uL 15.6 mL - pre-aliquoted into round bottom centrifuge tubes
EtOH 70% 400 uL 850 uL 12 mL
NaOAc 3M 10 uL 25 uL 325 uL
T10E5 100 uL 225uL 3 mL
EtOH 100% 200 uL 450 uL 6 mL
T10E1 50 uL 125 uL 1.625 mL
2022 DNA extraction lab manual

5.1 DNA extraction for genotyping

5.1 DNA extraction for genotyping kdorfman Tue, 03/22/2022 - 13:11

From Elizabeth Vierling

Per Reaction:

  • 500 uL Edwards Extraction Buffer (6.5 mL/pair, 100 mL/class)

  • 300 uL Isopropanol (3.9 mL/pair, 50 mL/class)

  • 100 uL T10E1 (1.3 mL/pair, 20 mL/class)

  • 1 2-mL grinding tube (12 tubes/pair, 50/class)

  • 2 steel beads (24 beads/pair, 300 beads/class)

Per class * Dresch ball mill grinder

  • 6 microcentrifuge

  • 6 vortex

Edwards DNA Extraction 2022-1-7.docx

5.2 Genotyping Salk mutants (PCR)

5.2 Genotyping Salk mutants (PCR) kdorfman Thu, 03/24/2022 - 18:15

Check extracts for DNA

  • 1% gels
  • HW Massruler

Amplify extracted DNA 24 PCR reactions per pair (12 WT + 12 Salk)

Reagent WT allele master mix uL mutant master mix uL per pair per class
H2O 243.25 243.25 486.5 ~6 mL
10X ex taq buf 35 35 70 ~145 uL
dNTP 28 28 60 720 uL
LBP 17.5 17.5 210 uL
GSP 1 17.5 ?
GSP 2 17.5 ?
Taq 5U/uL 1.75 uL 1.75 uL 3.5 uL 42 uL

6.4 RNA extraction 2022

6.4 RNA extraction 2022 kdorfman Tue, 04/19/2022 - 14:18

RNA Extraction

Materials for the class:

  • 6 centrifuges
  • Tissuelyzer blocks in the -80
  • LN2
  • Freezer box to keep RNA in the -80

Materials per group:

  • scissors
  • ice bucket
  • jeweler's scale
  • 6 grinding tubes with 2 metal beads each
  • 6 lilac columns
  • 6 pink columns
  • 6 capless collection tubes

Reagents per group:

  • ~3 mL RLT + β-Mercaptoethanol
  • 1.5 mL 95% Ethanol
  • 4.2 mL buffer RW1
  • 6 10 uL aliquots DNAse
  • 420 uL buffer RDD
  • 6 mL buffer RPE
  • 300 uL RNase free water

6.5 RT qPCR

6.5 RT qPCR kdorfman Thu, 04/21/2022 - 20:08

One-step RT-qPCR

One-step RT-qPCR kdorfman Tue, 04/26/2022 - 14:18

Luna Universal One-Step RT-qPCR

NEB E3005S, 200 rxns

  • Prepare RNA of interest using desired RNA extraction and purification methods. Determine concentration by OD260 absorbance.
  • Make dilutions of RNA to be used for the standard curve. These should be prepared fresh before each experiment and can be diluted in either water or TE.

Reaction Setup: For best results, we recommend running each RNA standard and sample in triplicate.

COMPONENT 20 µl REACTION FINAL CONC
Luna Universal One-Step Reaction Mix (2X) 10 µl 1X
Luna WarmStart® RT Enzyme Mix (20X) 1 µl 1X
Forward primer (10 µM) 0.8 µl 0.4 µM
Reverse primer (10 µM) 0.8 µl 0.4 µM
Template RNA variable < 1 µg (total RNA)
Nuclease-free Water to 20 µl

  1. Thaw Luna Universal One-Step Reaction Mix and other reaction components at room temperature, then place on ice. After thawing completely, briefly mix each component by inversion, pipetting or gentle vortexing.

  2. Determine the total volume for the appropriate number of reactions, plus 10% overage and prepare assay mix of all components except RNA template accordingly. Mix thoroughly but gently by pipetting or vortexing. Collect liquid to the bottom of the tube by brief centrifugation.

  3. Aliquot assay mix into qPCR tubes or plate. For best results, ensure accurate and consistent pipetting volumes and minimize bubbles.

  4. Add RNA template to qPCR tubes or plate. Seal tubes with flat, optically transparent caps; seal plates with optically transparent film. Care should be taken to properly seal plate edges and corners to prevent artifacts caused by evaporation.

  5. Spin tubes or plates briefly to remove bubbles and collect liquid (1 minute at 2,500–3,000 rpm).

  6. Program real-time instrument with indicated thermocycling protocol (see table below). Ensure a plate read is included at the end of the extension step.

CYCLE STEP TEMP TIME CYCLES
Reverse Transcription 55°C1 10 minutes 1
Initial Denaturation 95°C 1 minute 1
Denaturation
Extension		 95°C
60°C		 10 sec
30 sec2 (+ read)		 40-45
Melt Curve 60-95°C3 various 1

Notes

  1. A 55°C RT step temperature is optimal for Luna WarmStart Reverse Transcriptase. To ensure best performance and full WarmStart activation, avoid using a temperature of < 50°C. ↩︎

  2. For Applied Biosystems real-time instruments use a 60 second extension step. ↩︎

  3. Follow real-time instrument recommendations for melt curve step. ↩︎

RT, qPCR

RT, qPCR kdorfman Tue, 04/26/2022 - 14:16

Separate RT & qPCR

RT 10 groups @ 6 rxns 2 groups @ 8 rxns

Equipment

Hot blocks at

  • 50°C (2 dry baths - this is the long step and there are at least 4x as many tubes as groups),
  • 65°C
  • 70°C
    reagent uL/rxn uL/8 rxn (+ xtra) uL/class notes
    Oligo dT 50 µM 1 1 15 180
    10 mM dNTP mix 2 1 15 180
    RNAse-free water 11 + 40 60 720 aliquot once for both RT and qPCR
    5X 1st strand buffer 4 60 720 comes with Superscript
    0.1M DTT 1 15 125 1500 | comes with Superscript
    RNaseOUT 3 1 8 96 Dispensed from freezer box during lab
    Superscript 4 1 8 96 Dispensed from freezer box during lab

864 rxns @ 10uL

(24 x 3 rxns per group x 12 groups)

Reagent uL per rxn uL per 75 rxns
2x SYBR Green master mix5 5 uL 375 uL
water <5 uL 375 uL
forward primer 0.5 uL
reverse primer 0.5 uL
cDNA ~1 uL

  1. Fisher FERSO131 Oligo dT 100 µM (=0.5µg/µL) 60 µL @ ~$50. Dilute to 50µM!! (for emergencies: 50 µM oligo(dT) Fisher stockroom: C1101 0.5µg/µL x 40µL = 20µg) - Order T(18) from Invitrogen??? ↩︎

  2. 14 µL each + 84 µL RNase-free water OR Fisher FERR0192 ↩︎

  3. Invitrogen 10777019 RNAse out 5KU @ $143 ↩︎

  4. superscript III 200U/µL Invitrogen 18080044 10KU @ $259

    qPCR ↩︎

  5. Thermo Fisher 4385612 ↩︎

Gel purification

Gel purification kdorfman Tue, 03/29/2022 - 16:21

Zymoclean Gel DNA Recovery Kit Zymo Research D4002

  • Add 26 mL 95% EtOH to the 6 mL DNA Wash Buffer concentrate
  • Excise DNA fragment (x-tracta Gel Extraction Tool or razor blade)
  • Add 3X volume ADB (OR 300 uL ADB/mg gel)
  • Incubate 37-55C 5-10 minutes or until gel is dissolved
  • transfer melted agarose solution to Zymo Spin Column in a Collection Tube
  • centrifuge 10 - 16K Xg 30-60 sec
  • add 200 uL DNA Wash Buffer
  • Discard flow-through
  • Repeat with another 200 uL DNA Wash Buffer. Discard flow-through again
  • Add >= 6 uL DNA Elution Buffer (or water)
  • Put into clean 1.5 mL tube
  • Spin 30-60 sec to elute DNA.

Per rxn:

Reagent amount aliquot for 2 rxns for 3 rxns
ADB1 300 uL 640 uL 950 uL
DNA Wash Buffer 400 uL 840 uL 1250 uL
ENA Elution Buffer 6 uL 15 uL 22 uL (or water?)
  • Jewelry scale to weigh gel
  • Hot block 55 C for incubation and melting of agarose
  • gel excision tools
  • 2 mL tube for melting gel
  • vortex

  1. volume depends on size of excised gel piece ↩︎

Zymoclean Gel DNA Recovery Kit protocol

Planting schedule 2022

Planting schedule 2022 kdorfman Thu, 12/23/2021 - 15:54

Pots for students to plant seeds for genomic DNA

12 pots for Week 1 (1/26/22)

Planting for Week 5:

Arabidpsis essentials (2/23/22):

  • 2 seeds in each of 6 rose pots every week,
  • starting 1/12 (2 week before classes begin),
  • for a total of 36 pots
  • 6 1/2 MS plates 1 week before week 5 (seeds to fridge on 2/14/22)

Students plant mutant seeds:

  • 12 groups, 2 pots mutants, 2 pots Col0
  • for a total of 48 3" pots

Planting for Week 11:Gene expression planning:

Seeds on plates for RNA low and high iron experiments: ? at least 12 1/2 MS plates, 6 plates low iron.

5 seeds in each of 24 pots every week for 4 weeks, starting 6 weeks before week 11. (weeks 7, spring break, 8, and 9), for a total of 96 pots

1 row of seeds on each of 24 plates, 1 week before week 11

Date plant for
1/12 6 rose pots 6 week old Arabidopsis
1/19 6 rose pots 5 week old Arabidopsis
1/26 6 rose pots 4 week old Arabidopsis
2/02 6 rose pots 3 week old Arabidopsis
2/09 6 rose pots 2 week old Arabidopsis
2/16 6 1/2 MS plates 1 week old Arabidopsis
2/23
3/01 12 1/2 MS plates seedlings on cellophane for cDNA (iron expt)
3/03 plates to growth chamber start seedlings growing
3/07 24 pots 6 week old for gene expression
3/11 txfer plated seedlings half to MS, half to low iron
3/14 harvest iron expt seedlings Stavroula makes cDNA
3/14 24 pots 5 week old for gene expression
3/21 24 pots 4 week old for gene expression
3/28 24 pots 3 week old for gene expression
4/06 24 plates 2 week old for gene expression
4/13 24 plates 1 week old for gene expression

Course Prep

Course Prep margaret Wed, 11/16/2011 - 18:35
  • Make stickers for tubes
  • Order enzymes (Do all Qiagen orders together to save on shipping)
  • Clean waterbath
spot_labels_gga.docx

Enzymes & kits

Enzymes & kits kdorfman Wed, 01/18/2012 - 23:28
  • Takara Ex-Taq
    giant economy size: RR001B 4x 250U $590 at Clontech
    $843 at Fisher


Fisher equivalent has this buffer: Tris-HCl 100mM, pH 9, KCl 500 mM, MgCl2 15 mM. Takara buffer is 20 mM MgCl2

  • try this? cheap Taq at http://www.bulldog-bio.com/bioreadyrtaq.html

  • Invitrogen 18080044 superscript III 200U/µL 10KU @ $259

  • Invitrogen 10777019 RNAse out 5KU @ $143

  • Invitrogen RNAse A Check supply.

  • Qiagen 79254 DNAse
    includes RNase-free water and RDD for diluting the DNAse

  • Qiagin RNEasy 74904

    • if needed RW1 1053394
    • if needed RLT 79216

  • Quantifast 204054 400 rxns for q pcr

  • Zymo Clean & Concentrator kit

  • Oligo-dT Fisher FERSO131 Oligo dT 100 µM 60 µL @ ~$50. Dilute to 50µM!! (for emergencies: 50 µM oligo(dT) Fisher stockroom: C1101 0.5µg/µL x 40µL = 20µg)

link title

en-rnase-free-dnase-set-handbook.pdf

2015 (S) Restriction list

2015 (S) Restriction list kdorfman Fri, 02/06/2015 - 16:03
Enzyme Cut Smart NEB 1 NEB 2 NEB 3 NEB 4
Aat2 100 10 50 50
Acc651 25 10 75 100
Acl1 100 10 10 10
AflII 100 50 100 10
Age1[^1] 75 100 75 25
AlwN1 100 10 100 50
Apal1 100 100 100 10
Asc1 100 10 10 10
Ava1 100 10 100 25
Ava2 100 50 75 10
BamH1-HF 100 100 50 10
BciVI 100 100 25 10
Bgl2 10 10 10 100
BmgB1 10 10 10 100
BsaI 100 75 75 100
BspD1 100 25 75 50
BspE1 10 10 10 100
BsrB1 100 50 100 100
BsrG1 25 25 100 100
Cla1 100 10 50 50
Dra1 100 75 75 50
Eag1 10 10 25 100
Ear1 100 50 10 10
EcoR1 50 25 100 50
EcoRV-HF 100 25 100 100
HaeIII 100 50 100 25
Hha1 100 25 100 100
Hind3 50 25 100 50
Hind3 50 25 100 50
HinP1I 100 100 100 100
Hpa1 100 10 75 25
Hpa2 100 100 50 10
Kas1 100 50 100 50
Mbo1 100 75 100 100
Mlu1 25 10 50 100
Msp1 100 75 100 50
Nae1 100 25 25 10
Nco1 100 100 100 100
Nde1 100 75 100 100
Nhe1-HF 100 100 25 10
Pst1 50 75 75 100
Pvu1 10 10 25 100
Pvu2 100 50 100 100
Rsa1 100 25 50 10
Sac1 100 100 50 10
Sac2 100 10 100 10
Sal1 10 10 10 100
Sau3A1 100 100 50 10
Sca1 NR NR NR 100
SexA1 100 100 75 50
Spe1 100 75 100 25
Sph1 100 100 100 50
SphI
SSpI
Sty1 10 10 25 100
Sty1-HF 100 25 100 25
Xba1 100 10 100 75
Xcm1 100 10 100 25
Xho1 100 75 100 100
Xma1 100 25 50 10

[^1] gone as of 9/16

re_gene_and_genome.xlsx
restriction_list_fa2016.xlsx

2017S Restriction list

2017S Restriction list kdorfman Mon, 02/13/2017 - 17:11
Enzyme Cut Smart NEB 1 NEB 2 NEB 3 NEB 4
Aat2 100 10 50 50
Acc651 25 10 75 100
Aci1 100 10 25 100
Acl1 100 10 10 10
AflII 100 50 100 10
Age1 75 100 75 25
AlwN1 100 10 100 50
Apal1 100 100 100 10
Asc1 100 10 10 10
Ava1 100 10 100 25
Ava2 100 50 75 10
BamHI-HF 100 100 50 10
BciVI 100 100 25 10
Bgl2 10 10 10 100
BmgB1 10 10 10 100
BmsAI 100 50 100 100
BsaI 100 75 75 100
BspD1 100 25 75 50
BspE1 10 10 10 100
BsrB1 100 50 100 100
BsrG1 25 25 100 100
Cla1 100 10 50 50
Dra1 100 75 75 50
Eag1 10 10 25 100
Ear1 100 50 10 10
EcoR1 50 25 100 50
EcoRV-HF 100 25 100 100
HaeIII 100 50 100 25
Hha1 100 25 100 100
Hind3 50 25 100 50
Hind3 HF 100 10 100 10
HinP1I 100 100 100 100
Hpa1 100 10 75 25
Hpa2 100 100 50 10
Kas1 100 50 100 50
KpnI-HF 100 100 25 10
Mbo1 100 75 100 100
Mlu1 25 10 50 100
Msp1 100 75 100 50
Nae1 100 25 25 10
Nco1 100 100 100 100
Nde1 100 75 100 100
Nhe1-HF 100 100 25 10
Pst1 50 75 75 100
Pvu1 10 10 25 100
Pvu2 100 50 100 100
Rsa1 100 25 50 10
Sac1 100 100 50 10
Sal1 10 10 10 100
Sau3A1 100 100 50 10
Sca1 NR NR NR 100
SexA1 100 100 75 50
Sma1 100 10 10 10
Spe1 100 75 100 25
Sph1 100 100 100 50
SSpI 50 50 100 50
Sty1 10 10 25 100
Sty1-HF 100 25 100 25
Xba1 100 10 100 75
Xcm1 100 10 100 25
Xho1 100 75 100 100

G&GA solutions

G&GA solutions kdorfman Fri, 01/13/2012 - 17:55

Make solutions (Check supplies first)

See stock solution recipes

Aliquot:

Solution vol aliquots/pair total aliquots for Labs
T10E1 1 mL 5 50 1.1, 1.2, 2.4, 3.3
T10E5 0.75 mL 2 20 1.1
EtOH 95% 1.5 mL 2.2 22 1.1, 5.4
EtOH 70% 7.5 mL 1.2 12 1.1
isopropyl 7.5 mL 1.2 12 1.1
NaOAc 100 µL 1.2 12 1.1
KOAc 5 mL 1.2 12 1.1
DEB 10 mL 1.2 12 1.1
Tris pH 7.5 10 mM 1.5 mL 3 30 1.2, 5.4
loading dye 50 µL 1.5 15 1.2, 2.4, 2.5, 3.4, 5.4, 5.6
HMW std 15 µL 1.2 12 1.2
dNTP 2.5 mM 150 µL 1.5 15
sterile H2O 1 mL 6 60 2.4, 2.5, 3.3, 5.5
LMW std 50 µL 1.5 15 2.4, 2.5, 3.4, 5.4, 5.6
fermentas_calcs.xls

solutions calcs

solutions calcs kdorfman Fri, 07/12/2013 - 20:59
Forpairs
Reagent vol/aliquot aliquots/pr tot aliquots total vol
T10E1 mL
T10E5 mL
EtOH 95% mL
Isopropyl mL
NaOAc mL
KOAc mL
Loading dye mL
Mass ruler mix mL
dNTP 2.5 mM mL
Sterile water mL
Tris pH 7.5 10 mM mL

solutions_calc_template.txt

G&GA stations

G&GA stations kdorfman Fri, 01/13/2012 - 18:53

Each Station should have the following items:

Top Drawer

  • 2 gel rigs
  • 2 gel trays
  • 2 pencils
  • 1 alcohol-resistant marker, not Sharpie
  • 1 scissors
  • 1 forceps
  • 1 roll label tape
  • 3 micropipettors: 20μL, 200μL, 1000μL
  • 3 boxes pipet tips: 20μL, 200μL, 1000μL
  • spatula
  • funnel
  • 1 package 10 mL pipettes
  • 1 10mL pipet filler
  • 2 microfuge racks
  • 2 test-tube racks
  • scotch tape
  • ruler
  • timer

Second Drawer

  • 2 250 mL flasks
  • 1 1L beaker of microfuge tubes
  • 1 freezer box

Third Drawer

  • 2 gel casting trays
  • 2 levels
  • 2 15-well combs
  • 2 8-well combs

Each bench should have the following to be shared:

  • 1 waste beaker
  • ice bucket
  • 1 box Kimwipes
  • microfuge
  • DNA Engine Thermocycler
  • Dissecting microscope
  • Parafilm
  • 3 boxes gloves: sm, med, lg
  • Biology of Plants by Peter Raven

Planting guide

Planting guide kdorfman Mon, 01/16/2012 - 15:48

Check seed stocks before planting - some germinate better than others!!

Hydroponics video: https://www.youtube.com/watch?v=c9neVLaS63c

Hydroponics paper: http://www.plantmethods.com/content/9/1/4

2012 Schedule

2012 Schedule kdorfman Fri, 12/16/2011 - 17:10

Potting on soil

date wks before Lab purpose per pot pots/pair # pots
1/4 8 0.3 demo 3-5 1 10
1/11 7 0.3 demo 3-5 1 10
3 1.1 DNA lots! 4 40
1/18 6 0.3 demo 3-5 1 10
2 1.1 DNA lots! 4 40
1/25 5 0.3 demo 3-5 1 10
2/1 4 0.3 demo 3-5 1 10
2/8 3 0.3 demo 3-5 1 10
2/15 2 0.3 demo 3-5 1 10
2/27 6 5.3 projects 3-5 1 10
3/6 5 5.3 projects 3-5 1 10
3/13 4 5.3 projects 3-5 1 10
3/20 3 5.3 projects 3-5 1 10
3/27 2 5.3 projects 3-5 1 10

Planting on plates

date for Lab purpose # plates notes
2/22 0.3 demo 10 1 weeks before lab
3/26 5.3 projects 10 2 weeks before lab
4/3 5.3 projects 10 1 weeks before lab
2012_monthly_sun_us_holidays_landscape.doc

Calendar Spring 2012

Calendar Spring 2012 kdorfman Tue, 12/20/2011 - 16:29

January 2012

Sun Mon Tue Wed Thurs Fri Sat
1 Holiday 2 3 4 Plant 5 6 7
8 9 10 11 Plant 12 13 14
15 16 Holiday 17 18 Plant 19 20 21
22 23 24 25 Plant 26 27 28
29 30 31

February 2012

Sun Mon Tue Wed Thurs Fri Sat
1 Plant 2 3 4
5 6 7 8 Plant 9 10 11
12 13 14 15 Plant 16 17 18
19 20 Holiday 21 22 23 24 25
26 27 Plant 28 29

March 2012

Sun Mon Tue Wed Thurs Fri Sat
1 2 3
4 5 6 Plant 7 8 9 10
11 12 13 Plant 14 15 16 17 Spring Break
18 19 20 Plant 21 22 23 24
25 26 27 Plant 28 29 30 31

April 2012

Sun Mon Tue Wed Thurs Fri Sat
1 2 3 4 5 6 7
8 9 10 11 12 13 14
15 16 Holiday 17 (Mon) 18 19 20 21
22 23 24 25 26 27 28
29 30

May 2012

Sun Mon Tue Wed Thurs Fri Sat
1 Last day 2 3 4 5
6 7 8 9 10 11 12
13 14 15 Grades due 16 17 18 19
20 21 22 23 24 25 26
27 28 Holiday 29 30 31

On plates

On plates kdorfman Mon, 01/16/2012 - 15:45

Planting on Plates

Make MS plates

  • To get weakling mutants started before potting in soil
  • Or to plant seeds on specified media
  • Or to see roots

Seed Preparation

Seeds must be sterilized before they are put on sterile plates.

After sterilization,

  • Make a line of seeds in agarose above the midline of the plate, either
    • either on the agar directly
    • on flattened cellophane
  • Tape plates shut with Micropore surgical tape
  • Stack plates flat
  • Refrigerate the plates for 2 days in the dark
  • Move plates to growth chamber
  • Stand plates on edge under the lights. Tape several together.

0.1% agarose for plating seeds

  • 100 mL sterile ddH2O
  • 0.1 g agarose . autoclave to melt; shake bottle after autoclaving

Sterilize seeds with EtOH & Tritonx

Sterilize seeds with EtOH & Tritonx kdorfman Mon, 02/14/2022 - 18:31

  • sterilize seeds in a solution of

    • 0.5 mL 70% EtOH,
    • 0.05% TritonX-100,
    • ~3 min mild agitation.

  • Let seeds settle, remove liquid

  • Replace with sterile water, 3X

  • Replace water with sterile 0.1% agar, 3X

  • Plate in a line, either

    • directly on agar, one seed per tiny drop or
    • on flattened cellophane (wet it if necessary)

  • Wrap plates with micropore tape

  • stack plates flat

  • cover in foil, refrigerate, 48 hours

Sterilize seeds with EtOH then dry

Sterilize seeds with EtOH then dry kdorfman Mon, 02/14/2022 - 18:39

  • Put appropriate number of seeds in a sterile microfuge tube

  • Sterilize filter paper with EtOH, let dry in sterile hood (can set it on top of an open sterile petri plate cover

  • Add 95% EtOH to seeds for 5 min, dump seeds onto filter paper

  • let dry, tap onto agar of an MS plate

Sterilize seeds with bleach

Sterilize seeds with bleach kdorfman Mon, 02/14/2022 - 18:37
  • Add ~1mL of bleach solution to each tube
  • Cap and shake
  • Leave tube on its side for 20-30 min, shaking periodically
  • Put upright after last shake (so seeds settle)
  • In laminar flow hood
    • Use a pipetman that has been sprayed with ethanol and air-dried in the hood
    • Remove as much bleach solution as possible from the tube
    • Add ~1 mL sterile ddH2O, mix and let seeds settle again
    • Do at least 4 washes, to dilute out the bleach
    • Add ~1mL sterile 0.1% agarose (so seeds will be suspended in the liquid)

Bleach solution for sterilizing seeds

  • 7 mL sterile ddH2O (must be freshly made!)
  • 3 mL Chlorox
  • 1 uL Triton X-100 (detergent to help get bleach into seed crevices)

0.1% agarose for plating seeds

  • 100 mL sterile ddH2O
  • 0.1 g agarose . autoclave to melt; shake bottle after autoclaving

On soil

On soil kdorfman Mon, 01/16/2012 - 15:43

Arabidopsis planting guide - Plants on soil

Routine weekly planting to produce plant material for observation or DNA extraction

  • Pots
    • 6 pots in a big flat with no holes
    • fill with clump-free potting soil, leaving some space at the rim
  • Treat with Gnatrol for fungus gnats
    • saturate with hot water the night before Teddi comes
    • Arrange for Teddi to do Gnatrol treatment
  • OR Heat in oven
    • pre-heat oven to 225F (=~107C)
    • Put soil-filled pots in aluminum lasagne pan
    • Cover with foil
    • insert thermometer in one pot near center
    • Heat to 180F (=~82C)
    • leave in oven for 30 min.
    • leave covered until ready to plant
  • Seeds for DNA
    • Start a set 4 weeks before needed, another set 3 weeks before
    • Columbia wild type (col-0)
    • Scatter seeds on surface of soil (remoisten before if it is dry)
    • Put on plastic cover
    • Put in refrigerator, keep dark (this synchronizes germination)
    • Transfer to growth chamber on the third day
    • If no room in fridge, put seeds in microfuge tube, add water, refrigerate in dark 2 days, then plant
  • Seeds for demo or experimental plants
    • Put seeds in microfuge tube, water, refrigerate, keep dark
    • 3rd day: pour into small beaker, add more water
    • Deposit one seed to each corner of the pot, plus one in the middle with a transfer pipet.
    • Transfer to growth chamber
  • Growth Chamber
    • 22C, 16H light, schedule continuous program
    • Water bottom flat ~3x per week
    • Remove cover after plants are well established.

hydroponics

hydroponics kdorfman Thu, 05/22/2014 - 21:33

http://www.plantmethods.com/content/9/1/4

http://www.bio-world.com/productinfo/3_44_292/124429/Magenta-GA-Plant-C…

2015 attempt

  • Make 1x MS, pH to 5.6

  • Split: most as growth medium, a little bit for 0.7% agar (err on the low end), sterilize

  • Cut lids off microfuge tubes, poke a hole in each, sterilize in a beaker

  • line lids up, flat side down, on a strip of scotch tape

  • fill with 0.7% agar.

  • put lids into floatie or other rack.

  • put 1 sterilized seed in each hole. (in 0.1% agar)

  • Wrap with saran wrap

  • Cover tightly with foil, stratify in refrigerator for 2-3 days

  • Remove foil, put container in growth chamber at 16h day, 22C

  • Transfer lid to 50 mL tube with hole drilled in it at ~3 weeks.

  • Aerate or stir medium

cDNA

cDNA kdorfman Mon, 01/16/2012 - 16:22

*

cDNA 2010

cDNA 2010 kdorfman Fri, 05/24/2013 - 16:45

*Making cDNA +Fe & -Fe roots and shoots**

20 MS plates, heavily sown with At Col0 seeds.

At 7 days, transplant all seedlings, half to MS plates, half to –Fe plates.

After 3 more days, harvest roots, shoots. 12 samples in all.

(In future, plant 4 full plates per root sample)

Use razor blade to amputate roots

Grind in ceramic mortar and pestle (bake 1st overnight!)

Extract RNA, following lab manual protocol.

From 5/7/10:

Sample ng RNA/uL uL to get 200 ng uL to get 44.5 ng H2O to 5 uL
R+1 23.84 8.39 1.87 3.13
R+2 95 2.11 0.47 4.53
R+3 24.5 8.16 1.82 3.18
S+1 67.35 2.97 0.66 4.34
S+2 32 6.25 1.39 3.61
S+3 73.6 2.72 0.60 4.40
R-1 9.5 21.05 4.68 0.32
R-2 8.9 22.47 5.00 0.00
R-3 18 11.11 2.47 2.53
S-1 98.75 2.03 0.45 4.55
S-2 76.45 2.62 0.58 4.42
S-3 79.05 2.53 0.56 4.44

max ng in most dilute sample= 44.50

Can’t get 200 ng RNA in less than 5 µL in several samples.

Calculate the amount of RNA in 5 µL of the most dilute sample (-R2), calculate the µL of each sample required to get that amount. Add water to 5 µL.

Run on gel. R-3 was calculated wrong (or it degraded).

Initial spec reading was 6.3; reblanked and got 18. Maybe the 6.3 was right?

Gel:

Lane 1 2 3 4 5 6 7 8 9 10 11 12 13
HMW std R+1 R+2 R+3 S+1 S+2 S+3 R-1 R-2 R-3 S-1 S-2 S-3

Freeze the RNA.

Two choices for cDNA:
* omit R-3 (calculate amount of RNA from next most dilute, -R 2), * or recalculate R-3 from the initial 6.3 reading

From –R2: 11 µL contains 97.9 ng of RNA, almost 10% of the recommended amount.

Can run 11 RTPCR reactions, and only have 40 µL of R- samples, but 60 µL of all of the others.

From –R3 at 6.3ng/µL: 11 µL contains 69.3 ng, which is only 7% of the recommended amount.

Combine the 3 of each type into a single tube. Measure volume:

ingredient R- R+ S- S+
uL RNA 102 111 111 111
+ 1/10 vol 3M NaOAc 1 10.2 11.1 11.1 11.1
+ 2 vol EtOH 204 222 222 222

Freeze 20 min

Spin 10 min

Remove supernate

Add 70% EtOH

Spin again (R pellets hard to see)

Remove all liquid. Add:

ingredient R- R+ S- S+
1/4 vol RNAse-free H2O 25.5 27.75 27.75 27.75
spec ng/uL: 118.2 116.5 282.4 203

11 µL of least conc has 1281.5 ng

ingredient R- R+ S- S+
uL RNA 10.84 11 4.53 6.31
water 0.16 0 6.49 4.69

Proceed with RT, following lab manual protocol.

Run gel (1st one failed – pic is second run)

LMW 1/50 1/100 R+ S+ R- S- std gDNA gDNA

Complete waste of time and resources!

Test the cDNA with PCR

Test cDNA with oMZG_RT_L and oMZG_RT_R

(The primer names in the Wiki are oMZG_T_R and oMZG_T_L; in the freezer, there is oMZG_RT_L and oMZG_RT_R)

gDNA product is 482bp, cDNA is 362 (with some alternative splicing products in between).

Master Mix for 7 rxns (1/50 gDNA, 1/100 gDNA, R+, S+, R-, S-) + 1

ingredient per rxn per 7 rxns

water 36 252

10X buffer 5 35

2.5mM dNTP 4 28

oMZG_RT_L 1 7

oMZG_RT_R 1 7 T aq 1 7

Each rxn: 48 µL master mix + 2 µL template

Make 1/50 gDNA: 1 µL gDNA + 49 µL water

Make 1/100 gDNA: 10 µL 1/50 DNA + 10 µL water

Tube # 1 2 3 4 5 6 Sample 1/50 gDNA 1/100 gDNA R+ S+ R- S-

  1. make fresh, pH 7.0, filter sterilize ↩︎

cDNA 2013

cDNA 2013 kdorfman Fri, 05/24/2013 - 16:45

Make cDNA Summer 2013

Summary:

12 samples, 3 replicates of each treatment:

MS -> MS MS -> -Fe
shoots numbers 1-3 numbers 7-9
roots numbers 4-6 numbers 10-12

cDNA in 12 labeled tubes in freezer in 362 (each made with 1 µg RNA, using superscript III)

RNA in box in -80 in 262

number plant part Fe ng/µL µL RNA/1µg
1 shoot Fe+ 125.9 7.94
2 shoot Fe+ 328.5 3.04
3 shoot Fe+ 259.2 3.86
4 root Fe+ 318.1 3.14
5 root Fe+ 429.5 2.33
6 root Fe+ 282.6 3.54
7 shoot Fe- 883.7 1.13
8 shoot Fe- 427.9 2.34
9 shoot Fe- 432.4 2.31
10 root Fe- 224.3 4.46
11 root Fe- 258.8 3.86
12 root Fe- 139.9 7.15

sterilize seeds

sterilize seeds kdorfman Fri, 05/24/2013 - 18:33

  • sterilize seeds in 0.5 mL 70% EtOH, 0.05% TritonX-100, ~3 min, mild agitation.

  • Let seeds settle, remove liquid

  • Replace with sterile water, 3X

  • Replace water with sterile 0.1% agar, 3X

  • plate heavily in a line on flattened cellophane (wet it if necessary)

  • stack plates flat

  • cover in foil, refrigerate, 48 hours

test platforms

test platforms kdorfman Fri, 05/24/2013 - 18:38

Try different porous platforms for seedling growth

Get samples from Magdalena's lab

Sterilize between sheets of filter paper in a glass petri dish.

  • Moss cellophane

  • Roll cellophane

  • Magenta box screen

  • Sheer fabric

Seeds grow fine on flat cellophane. The roots have trouble getting over a bump or air bubble.

Seeds do not grow well on mesh fabric.

Wire screen does not lie flat on agar.

Put samples of each on MS agar

Iron experiment

Iron experiment kdorfman Fri, 05/24/2013 - 18:46

Grow Col0 seeds to test effect of iron deprivation on gene expression

Make plates:

Sow sterile seeds on cellophane in 12 MS plates as heavily as possible.

After stratification,

  • 7 days in incubator

  • Transfer half to iron-free plates, half to MS plates

  • Harvest after 3 days

Extract RNA

Extract RNA kdorfman Fri, 05/24/2013 - 18:49

Grind tissue

Grind tissue kdorfman Fri, 05/24/2013 - 19:13

Grind roots +/-, shoots +/- in ball mill (Sam's Retch Mixer Mill MM400)

  • Precool the white block for the ball mill

  • prepare 2 2-mL tubes per plate (label tubes on side as well as top)

    • 3 roots + iron
    • 3 roots - iron
    • 3 shoots + iron
    • 3 shoots - iron

  • 2 metal beads per tube 3.2mm diameter ss beads (90g) - Cat. No. 11079132ss from www.biospec.com (Can also get from Fisher)

  • cool in LN2

  • Add tissue to cold tube, put back in LN2

  • Put all tubes in cold block

  • Shake 20 sec, check. The heat of shaking may start to defrost the tissue. Throw it back in the LN2. (Shake too long, and the cap may disintegrate!

  • Return to LN2

RNEasy

RNEasy kdorfman Fri, 05/24/2013 - 19:30

Prepare RNA from powdered frozen tissue

Use RNeasy Plant Mini Kit (50) Qiagen 74904

  1. Add 450 µL Buffer RLT. Mix vigorously. Spin down.

  2. Transfer lysate to lilac Qiashredder in 2mL collection tube

  3. Spin 2 min, full speed

  4. Transfer flow-through (NOT PELLET) to new tube. Toss the lilac column

  5. Add 225 µL 100% EtOH to lysate. Mix by pipetting up and down

  6. Transfer entire sample to pink spin column in a 2 mL collection tube.

  7. Discard flow-through. Keep column.

  8. Add 350 µL RW1 to column. Spin 15 sec, full speed.

  9. Discard flow-through. Keep column

  10. Add 70µL RDD to 10 µL DNAse I. BE GENTLE. Put the 80 µL on the column. Incubate at room temp 15 min.

  11. Add 350 µL RW1. Spin 15 sec. full speed.

  12. Discard flow-through, reuse collection tube.

  13. Add 500 µL RPE to column. spin full speed 2 min.

  14. Put column in new capless collection tube. Discard old collection tube.

  15. Spin 1 min, full speed

  16. Add 30 µL RNAse-free water to column membrane. Spin 1 min, full speed.

  17. Repeat, with 20 µL RNAse free water.

  18. Transfer all 50 µL RNA to clean, labeled tube. Keep on ice

Reagents

Reagents kdorfman Mon, 05/27/2013 - 18:15
For RNEasy reactions
add: mL RLT
add: mL 100% EtOH
add: mL RW1
add: mL RDD
add: mL DNAse I
add: mL RPE
add: mL RNAse-free water

[RNA] by nano-drop

[RNA] by nano-drop kdorfman Fri, 05/24/2013 - 19:00
  1. Clean the pedestals

  2. Blank the machine

    1 µL buffer onto lower measurement pedestal

    F3 (Blank)

  3. Wipe again

  4. Test the blank:

    1 µL buffer

    F1 (Measure)

    if it's flat, you're good to go

  5. 1 µL sample. repeat.

RT

RT kdorfman Fri, 05/24/2013 - 18:50

Make cDNA by reverse transcription

Calculate the volume of each sample required to get 1 µg RNA

For reactions
with ng/µL RNA
add: µL oligo(dT)
add: µL RNA
add: µL 10mM dNTP mix
add µL water (final vol = 13µL/rxn) 65 C 1 min, then ice. Spin down.
add: µL 5X 1st strand buffer
add: µL 0.1M DTT
add: µL RNAseOUT
add: µL Superscript III (200U/µL). 50C 45 min. Stop rxn: 70C 15 min

Note I bought the 10 µL Superscript, mixed it with some leftover, and had enough to do one reaction per RNA sample (=60 µL per treatment). Should have bought the bigger size.

I should use some of the remaining RNA to try out the RT sample I got from Qiagen. Maybe the best 8 RNA's.

rnagelsfeexpt.xls
rnamass.xls
rna-for-fe-exp.jpeg
rna-for-fe-exp2.jpeg

0.1 Micro-mixology

0.1 Micro-mixology kdorfman Fri, 12/16/2011 - 16:35

Put out one set of 12 scintillation vials per 2 pairs of students.

Pour out anything that has gone cloudy.

Vortex to remix anything with paint.

To top up,

  • pour all vials into beaker

  • correct volume and color

  • re-aliquot.

Use Google images to find color pictures of triple sec and sour mix to match the color.

Use white paint tint from Cowl's Lumber

Except for red wine, mix food coloring with water first, then dribble the dilute colored solution into water to the desired hue.

Add ethanol or sodium azide as a preservative to the glycerol-based solutions and the coffee creamer.

pseudo: water or ETOH glycerol green yellow red black coffee creamer
vodka √
gin √
rum √
vermouth √ √
tequila √ √ √
grapefruit juice √ (√) √
orange juice √ √ √
sour mix 60% (√) √ √
ouzo 40%
triple-sec 20% √ √
red wine √ √√ √
cola √ √ √√

0.3 Arabidopsis anatomy

0.3 Arabidopsis anatomy margaret Wed, 11/16/2011 - 18:28

See planting schedule.

Grow Arabidopsis thaliana in individual little pots (about 2 seeds per pot), 2 pots per student pair, starting 7 weeks before class. Seems to work better with dry seeds. Thin them if necessary, so there are individual plants to examine.

Grow a few seeds on MS medium, one plate per student pair. Put into refrigerator about 1 week before class, into growth chamber about 5 days before class

Make enough MS plates for Lab 3.3. Use extra for demo.

Buy vegetables at the grocery store, enough for one complete set/pair or pair of pairs. At home, sort out the necessary amounts, then keep the rest.

Plant part representative vegetable
root carrot
leaf spinach
cotyledon edamame
petiole celery
rosette romaine lettuce
flower sprouted broccoli
seeds sesame seeds
silique sugar snap peas
fruit grape tomatoes
hypocotyl bean sprouts

Dissecting Scopes

✮Clean-up:✮

Put plant debris and used potting soil in the bucket labeled “Compost”. Add something about putting away dissecting microscopes

images.jpg

1.1 DNA extraction

1.1 DNA extraction kdorfman Fri, 12/16/2011 - 18:34

Wednesday 1/25/2012

Equipment for 1.1

Equipment for 1.1 kdorfman Mon, 12/19/2011 - 16:27
  • Water bath at 65C
  • Mortar & pestle
  • Dry bath at 65C
  • Centrifuge at 4C
  • 14 mL round bottom POLYPROPYLENE tubes with snap cap. (Becton Dickinson #352059: Fisher 14-959-11B stockroom item)
  • Paper & scotch tape
  • Miracloth (EMD_BIO-475855) & funnels
  • 4-8 pots of densely sown Arabidopsis 1 per pair
  • Medium weighboat for chopped up leaves
  • Paper diaper for bench
  • Liquid N2 + extra ice buckets
  • Stinky waste bucket in hood

  1. See planting schedule ↩︎

Reagents for 1.1

Reagents for 1.1 kdorfman Mon, 12/19/2011 - 17:19

Extracting genomic DNA from Arabidopsis thaliana

For pairs of students
make: aliquots of exactly 6 mL DEB in round-bottom tubes
make: 1 mL aliquots of T10E1
make: 1 mL aliquots of T10E5
make: 1.5 mL aliquots of EtOH 95%
make: 5 mL aliquots of EtOH 70
make: exactly 6 mL aliquots of isopropanol in round bottom tubes
make: 4 mL aliquots of KOAc 5M
make: 100 uL aliquots of NaOAc

Ingredient per pair per class
DEB exactly 6 mL in round-bottomed tube 100 mL
add 5 µL BME per tube at the last minute
T10E1 1 mL 4 mL/pair/semester. Make 100 1mL aliquots
T10E5 1 mL 15 mL
EtOH 95% 1.5 mL 50 mL
EtOH 70% 5 mL 100 mL
ISOprop exactly 6 mL in round-bottom tube 100 mL
KOAc 5M 4 mL 50 mL
NaOAc 3M pH 5.2 100 µL 5 mL

1.2 DNA Quantification

1.2 DNA Quantification margaret Wed, 11/16/2011 - 18:07

Goal for this lab:

Quantify Arabidopsis DNA by two methods. (It is hard to finish all the analysis in 3 hours – better if this happens on a Monday 4 hour lab. Otherwise save the gel analysis till the next period, along with the Wiki.)

For pairs of students
make: 1 mL aliquots DB (10 mM Tris pH 7.5) or T10E1
make: 100 µL aliquots 6X loading dye
make: 25 µL aliquots MassRuler High Range

6X Loading dye to be used throughout the semester: 100 µL

MassRuler™ DNA Ladder, High Range Fermentas #SM0393 Give them 25µL in a microfuge tube

Materials for DNA quant

Materials for DNA quant kdorfman Thu, 01/26/2012 - 16:41

EQUIPMENT

  • Turn on the spectrophotometers
  • Cut and distribute diaper pads
  • Make EtBr waste containers
  • Diapered area (to catch ethidium bromide drips)
  • sterile
    • microfuge tubes
    • tips
  • paper towels for handling gels
  • Cuvettes
    • Krackeler 478-759220 pack of 100ultra micro cuvettes, 15 mm window ht, Brand UV $71 list price
    • Fisher 13-878-123 BRAND* UV-Cuvette Disposable Cuvets from BrandTech* Ultramicro; 15mm window; 100/Pk $49.66 available at stockroom

Reading should be below 0.3 to stay in linear range. See graph showing loss of linearity for fluorescein (in 1M NaOH) absorbance in Jenova spec above Abs=0.3

2.1 - 2.3 Gene maps

2.1 - 2.3 Gene maps margaret Wed, 11/16/2011 - 18:00

2.1 Initial Working Maps of Unknown Genes 2/02/11

For 2013, order

  • BamHI
  • NheI
  • SpeI
  • SphI
  • StyI

2.2 Finalizing Gene Models 2/07/11

2.3 Choosing PCR Primers 2/09/11

Put primer choosing doc on website Make sure it includes primer names and sequences.

List of available restriction enzymes:

AatII
Acc65I
AclI
AflII
AgeI
ApaLI
AscI
AvaI
AvaII
BamHI
BglII
BspDI
BspEI
ClaI
EagI
EcoRI
EcoRV
FseI1
HaeIII
HhaI
HindIII
HinP1I
HpaI
HpaII
KasI
MboI
MluI
MspI
NaeI
NcoI
NdeI
NheI
PvuI
PvuII
RsaI
SacI
SacII
SalI
Sau3AI
ScaI
SpeI
SphI
StyI
XbaI
XhoI
XmaI

  1. keep at -80C ↩︎

primer_choosing_worksheet.doc

2.4 Testing PCR

2.4 Testing PCR margaret Wed, 11/16/2011 - 18:34

Aliquot enough for each pair, plus 2

Materials:

  • Ice bucket with ice

  • 0.2 mL PCR tubes and caps

  • 1 mL Sterile ddH2O (sterile double distilled water)

  • 1.5 mL T10E1 buffer (students already have some, but have more ready)

  • 150 µL dNTP mix (2.5 mM each dNTP) (use up old aliquots)

  • 150 µL 10× polymerase buffer (use up old aliquots) (not Taq buffer)

  • loading dye (at least 75 µL)

  • Low MW Fermentas MassRuler (at least 50 µL)

  • Fill carboy with 1 x TAE

  • Diaper paper

  • Primers

Taq

  • Students can take their 9 μL from the stock bottle, kept on ice at all times
    (4 DNA conc’s @2 µL + ½ rxn worth for pipetting slop)
    Students need Taq at 2U/ μL
    Stock comes as 5U/ μL, so make 100 μL:
    40 μL of 5U/ μL + 60 μL Taq dilution buffer (in freezer)

Make 2 tubes, so both instructors can carry them around in the freezer box

Waterbath at 65C

Gels (1.5%)

dorfmanumassbio383hprimers-1.xlsx
383h-tuth-2015f.xls

2.5 Restriction Mapping

2.5 Restriction Mapping margaret Wed, 11/16/2011 - 18:16

W 2/22/12

Goal for this lab: Purify the amplified DNA from first lab, digest it with restriction enzymes, and assess the results with gel electrophoresis.

Zymo Research DNA Clean & Concentrator-5 Cat # T1225 K

$69 for kit of 50

Reagents Per Pair:

  • 125 µL Zymo-SpinTM DNA Binding Buffer
  • 500 µL Zymo-SpinTM Wash Buffer (GET MORE FOR 2015)
  • 1 mL Sterile ddH2O
  • 1 Zymo-Spin™ Column
  • 2 Capless collection tubes

  • 10 µL 20 mM Spermidine [Should this be 3 tubes of 1 uL??]

  • 1x TAE for 14 gels @ 300 mL/gel = 4200 mL (make at least 5 L)

  • 1 2% gel per pair plus 2
  • 10x NEB restriction buffer. Students need at most 10µL of any 1 buffer. Check supplies
  • Fermentas MassRuler, Low Range

Restriction Enzymes for 2012

Grp enz 1 enz 2 NEB buffer
ASP Xho1 Hind3 2
BLW EcoRV Cla1 3, 4, (2)
CHC Bgl2 Cla1 3, 4
CNT pvu1 EcoRV 3
EFO Hpa1 Mlu1 4, 3
KSY Spe1 Sph1 2
LSO Sal1 EcoRV 3
NOD EcoRV Sac1 1, 2, 3, 4
RFR Cla1 Hind3 4,2,
RMT Bgl2 Pvu2 3

Bgl2 Cla1 EcoRV Hind3 Hpa1 Mlu1 pvu1 Pvu2 Sac1 Sal1 Spe1 Sph1 Xho1

Equipment

  • Incubator at 37C, with microtube racks inside
  • Water bath at 65C for gels
  • copies of semi-log paper (1 per student) (see attached document)
  • find powerpoint of semi-log paper and put it on the course website
semi-log_paper.doc
2-cycle_semi-log.pdf

2014 RE

2014 RE kdorfman Wed, 02/19/2014 - 20:04
MW TuTh buf1 buf 2 buf 3 buf 4 cutsmart
AatII Aat II 0 50 50 100 100
AclI AclI 100
AflII AflII 50 100 25 100 100
BciVI 100
Bgl2 10 75 100 10 10
BmgBI 3.1-100 10
BspE1 0 10 100 0 10
BsrBI 100
BsrGI 25
ClaI 10 50 50 100 100
DraI 100
EarI 100
EcoRI 100 100 100 100 50
EcoRV 50 75 100 50 10
HindIII HindIII 50 100 10 50 50
HpaI 25 50 10 100 100
MluI 25 75 100 50 25
NcoI 100 100 100 100 100
Pvu2 100 100 100 100 100
SexAI 100
SpeI 75 100 25 75 100
XbaI 0 100 75 75 100

2017 schedule

2017 schedule kdorfman Wed, 01/18/2017 - 19:28
draft_laboratory_schedule_2017.docx

2018

2018 kdorfman Thu, 01/18/2018 - 22:31
lab_0.1_introduction_to_micro-pipetting.pdf
lab_1.0_dna_extractions.pdf
mw2018.docx
roster_with_genes_gg_2018s.xlsx

2021 DNA Extraction

2021 DNA Extraction kdorfman Fri, 02/19/2021 - 16:57

Equipment:

  • Grinder
  • tongs
  • Ice buckets
  • Centrifuge
  • Freezer boxes
  • Compost buckets
  • B-mercaptoethanol waste bucket in fume hood

Reagents:

  • 1 mL DEB per sample
  • 415 uL KOAc per sample
  • Fresh round bottom 2 mL tube with 1 mL 70% ethanol
  • 500 uL 95% ethanol
  • 50 uL TE per sample

2021 RNA extraction

2021 RNA extraction kdorfman Fri, 04/16/2021 - 13:50

RNEasy Kit Qiagen 74904

Per reaction (6 x 23=138), :

  • LN2
  • Tissue flash frozen in LN2 in round bottom 2 mL tube with 2 grinding beads
  • Buffer RLT 450 uL
  • lilac QIAshredder in 2 mL collection tube
  • pink tube
  • 225 uL 100% ethanol
  • 350 Buffer RW1 x 2 (see below)
  • 10 uL DNAse (in RDD) IF NO INTRON
  • 70 uL RDD
  • 350 uL RW1
  • 500 uL RPE
  • 500 uL RPE
  • 30 uL RNAse free water
  • 20 uL RNAse free water
Reagent uL per rxn uL per 6.5 rxns
RLT 450 2925
EtOH 225 1462.5
RW1 700 4550
DNAse 10 65 (have ~570 uL, more on the way)
RDD 70 455
RPE 1000 6500
H2O 50 325

2021 RT & qPCR

2021 RT & qPCR kdorfman Fri, 04/16/2021 - 14:09

RT

6 RNA extractions, 6 cDNA reactions/group; 23 groups

  • 65C (thermocycler)
  • pcr strips
  • ice

Give each group enough for 7 reactions

Reagent uL per rxn uL per 7 rxns
50 uM oligo(dT) 1 7
RNA
10 mM dNTP 1 7
H2O 11 71.5
5X 1st strand buffer 4 28
0.1M DTT 1 7
RNAse out 1 7
Superscript III 1 7

qPCR

48 q pcr reactions/group (24 GOI, 24 HK) Give them enough for 50 reactions

Reagent uL per rxn uL per 50 rxns
2x SYBR Green master mix 5 uL 250 uL
water 5 uL 250 uL
forward primer 0.5 uL
reverse primer 0.5 uL
cDNA 1 uL

2024 Gene & Genome (Maresca)

2024 Gene & Genome (Maresca) kdorfman Mon, 08/19/2024 - 17:30

Slight modification of 2022

class day date topics
1 W 9/4 Tom: Intro to the course
Kate: intro to safety, fluorescence microscope
live GFP-tubulin S2 cell imaging on 8 conA coverslip dishes (prepared just before class)
pipetting part 1
2 M 9/9 pipetting part 2
microscopy HeLa slides
S2 culture (12 flasks)
3 W 9/11 Transformation
4 M 9/16 mini prep, pcr
5 W 9/18 0.9% gel, band extraction
6 M 9/23 invitro transcription kit; conA dishes
7 W 9/25 gel, + Nanodrop
8 M 9/30 ds RNA treatment
IF demo (Kate)
9 W 10/2 16 conA dishes (Tom)
5 mL S2 aliquots
10 M 10/7 immunostaining
11 W 10/9 repeat ds RNA treatment
make 1 conA coverslip per student
12 Tu 10/15 (M sched) IF (students seed coverslips and fix) on control and dsRNA treated cells
13 W 10/16 looking at coverslips (Ctrl vs treated)
14 M 10/21 presentations (in ILC?)
15 W 10/23 transformations (PXGFP); STLC (dishes); splitting demo
16 M 10/28 Miniprep, nanodrop, restriction digest (Bsb1)
17 W 10/30 gel, gel extraction (1 per student), anneal primers (1 per Group), isothermal reaction, Transformation of Competent Cells
45 min gel rather than 60 min?
15 min, not 15 sec on thermocycler for isothermal rxn
split HeLas while gels run
18 M 11/04 mini prep, (skip nanodrop)
1 uL 30 min test digest (BsmB1)
45 min test gel
split cells during either digest or gel, depending on lecture
19 W 11/06 transfection/a> of HeLa cells
20 W 11/13 look at cells, notice transformation efficiencies
21 M 11/18 Split parental flask
Nucleofect with Tm109 & Tm122 (1 µg each):
1 drop to dish, rest to flask
22 W 11/20 Check nucleofected dish for GFP (take images)
Set up coverslips from flask
23 M 11/25 IF w/ Rabbit anti-Ki67 green, tubulin red>
THANKSGIVING
24 M 12/01 Treat with nocodazole 1st thing
IF coverslips
26 W 12/04
27 M 12/09 Poster presentations in ILC (RESERVE ROOM)

IF demo

IF demo kdorfman Fri, 09/27/2024 - 14:41

2024/09/30 Monday

  • Set up camera to project
  • Use left over fixed MEF
  • Set up beaker of PBS-Tw-Az
  • Materials for humid chamber
  • forceps

3.2 Planting Salk seeds

3.2 Planting Salk seeds margaret Wed, 11/16/2011 - 18:30

3.1 Identifying T-DNA insertion sites 2/28/13

ORDER PRIMERS

Need homozygous strains for low iron testing. Indicated by Salk ________c

K Dorfman SALK-LB195
TCGGAACCACCATCAAACGGATT

K Dorfman SALK-LB205
CATCAAACAGGATTTTCGCCTGCT

LBb1.3 ATTTTGCCGATTTCGGAAC 110 bp from left border http://signal.salk.edu/tdnaprimers.2.html

3.2 Salk line genetics 3/4/13

Plant seeds of SALK lines and prepare to analyze the plants that will grow from them.

Prepare pots for students. 4 pots of soil per pair (plus extras), already treated with Gnatrol by Teddi

Imbibe seeds for students.
Per pair:

  • Half of their Salk line seeds (12 if possible)
    The other half will be sterilized and planted on agar plates in Lab 3.3

  • Equivalent number of Col 0 control seeds
    (one tube imbibed, one tube dry, just like the Salk seeds)
    use #6 from the Col0 rack in room 366A

  • Put in water in microfuge tube
    wrap each day's worth of seeds separately in foil - if they get any light, their radicles may start to emerge, and they become quite fragile)
    store in refrigerator by Friday afternoon for Monday lab

3.3 Salk phenotypes

3.3 Salk phenotypes margaret Wed, 11/16/2011 - 17:18

Change the lab manual so it says they have to follow any homozygous or heterozygous Salk plants throughout their entire life - till the end of the semester.

M 3/5/12

Per Pair:

  • Control seeds (aliquot ~25 into 12 microfuge tubes, dry)

  • Salk-line seeds (remainder from Lab 3.2, dry, ~25 per tube)

  • 2 mL 70% EtOH, 0.05% TritonX-100 (stock is 10%)

    • Make 50 mL, aliquot into microfuge tubes

    • 37 mL 95% EtOH

    • 0.25 mL 10% Triton-X
    • water to 50 mL

  • If seeds are to be plated in agar:

    • 0.1% agar, sterile
    • ~ 2 mL per pair
    • 0.1 g agar/100 mL, autoclave, aliquot.
    • Or aliquot into glass tubes, then autoclave

  • sterile water

  • If seeds are to be dried and plated from filter paper:

    • Filter paper (? 4 in a plastic Petri dish?)
    • Sterile forceps in tubes for handling filter paper
    • 10 mL 95% EtOH (aliquot 25 15mL tubes)

  • 2 complete medium plates per pair

  • 2 Low-Fe medium plates (1 µM Fe) per pair

  • micropore tape

Total plates (actually need 20 of each type)

  • 24 complete MS medium

  • 24 low Fe MS medium

salt-germination-10.xlsx

MS plates

MS plates kdorfman Mon, 12/19/2011 - 20:27

Murashige & Skoog Medium

30 mL per plate

Use the tall petri plates so the seedlings have more space

MS complete

MS complete kdorfman Mon, 12/19/2011 - 20:45
ingredient 750 800 1000 1200 1600 mL
number of plates 25 27 33 40 53
ddH2O* 450 480 600 720 960 mL
10X macronutrients 1 75 80 100 120 160 mL
10X micronutrients 2 75 80 100 120 160 mL
MES 0.375 0.4 0.5 0.6 0.8 g

*Add the other salt mixtures to the water to prevent precipitation

pH to 5.7 with 1M KOH (initial pH = ~3.66) (needs ~720 µL/L)

Bring to volume with distilled water

ingredient 750 800 1000 1200 1600 mL
bacto or phyto agar 7.5 8 10 12 16 g

autoclave with stir bar in flask or bottle

Stir until cool enough to handle

Pour 30 mL per plate (use the deep ones)

(Or Sigma M5524 - macro and micro nutrients together.)

  1. Sigma M 0654 Murashige and Skoog basal salt macronutrient solution (Krackeler 45-M0654-1L-EA) ~$26 ↩︎

  2. Sigma M 0529 Murashige and Skoog basal salt micronutrient solution (Krackeler 45-M0529-1L-EA) ~$26 ↩︎

MS nutrients

MS nutrients kdorfman Mon, 02/13/2012 - 19:56

MS macronutrients 10X

Sigma M 0654

Component mg/L
Potassium phosphate monobasic 170
Magnesium sulfate 180.7
Calcium chloride anhydrous 332.2
Ammonium nitrate 1650
Potassium nitrate 1900

MS micronutrients 10X

Sigma M 0529

Component mg/L
Boric acid 6.2
Cobalt chloride . 6H2O 0.025
Cupric sulfate. 5H2O 0.025
Ferrous sulfate.7H2O 27.8
Manganese sulfate. H2O 16.9
Molybdic acid (sodium salt) o 2H2O 0.25
Na2-EDTA 37.3
Potassium iodide 0.83
Zinc sulfate.7H2O 8.6

MS low iron

MS low iron kdorfman Mon, 12/19/2011 - 21:12

**Murashige & Skoog 1µM iron medium

MS 10x micronutrients is 100 µM FeSO4, so MS complete is 10 µM

FeSO4 stock is 10 mM, which is 10,000x 1 µM

To make plates low-iron MS
start with mL ddH2O (~ 60% final volume)
add: mL 10X macronutrients
add: mL boric acid 1000X
add: mL cobalt chloride 10,000X
add: mL cupric sulfate 10,000X
add: mL ferrous sulfate 10 mM
add: mL KI 10,000X
add: mL manganese sulfate 1000X
add: mL moybdic acid 10,000X
add: mL zinc sulfate 1000X
add: g MES, pH to 5.7 with KOH
bring to mL final volume
add: g bacto- or phyto-agar
autoclave for minutes

ingredient 750 1000 1200 1500 mL
number of plates 25 33 40 50
ddH2O* 450 600 600 960 mL
10X macronutrients 75 100 120 150 mL
boric acid 1000x 0.75 1.0 1.2 1.5 mL
Cobalt chloride 10,000x 0.075 0.1 0.12 0.15 mL
cupric sulfate 10,000x 0.075 0.1 0.12 0.15 mL
ferrous sulfate 10,000x 0.075 0.1 0.12 0.15 mL
KI 10,000x 0.075 0.1 0.12 0.15 mL
manganese sulfate 1000x 0.75 1.0 1.2 1.5 mL
molybdic acid 10,000x x 0.075 0.1 0.12 0.15 mL
zinc sulfate 1000x 0.75 1.0 1.2 1.5 mL
MES 0.375 0.5 0.6 0.75 g

*Add the other salt mixtures to the water to prevent precipitation

pH to 5.7 with 1M KOH (initial pH = ~4.6) (needs ~570 drops/L)

Bring to volume with distilled water

ingredient 750 1000 1200 1500 mL
bacto or phyto agar 7.5 10 12 15 g

autoclave with stir bar in flask or bottle

Stir until cool enough to handle

Pour 30 mL per plate (use the deep ones)

3.4 Leaf Squish & PCR

3.4 Leaf Squish & PCR margaret Wed, 11/16/2011 - 18:38

The yield is low - many student get no bands at all. Not much better than when we used the older quick squish buffer.

One pair repeated the experiment with quick squish and did no better.

Check primers first?

Salk genotyping: Leaf Squish & PCR

See revised instructions handout below.

CORRECT PCR CALCS IN HANDOUT

correct PCR cycle. should be

  • 98C 15s
  • 60C 30s
  • 72C 1min 32-40 cycles

Goal for this lab: Genotype Salk line plants, looking for homozygous mutants.

the RP is always on the side of the flanking sequence, that is, RP is always on the 3' end of the insertion. Therefore, the PCR reaction should always be set up as LB+RP for HM and LP+RP for WT. http://signal.salk.edu/tdnaprimers.2.html

Use 3 primers in a single reaction (GSP1, GSP2, LBP) OR

Run 2 separate gels

LB 195

LBb1.3 ATTTTGCCGATTTCGGAAC (111 bp from left border)

Should be on a long-lab day! If it can't be on the long day, it should stop at DNA extraction, then do PCR plus gel the next period!

Set out the 24-tube microcentrifuges. They have 13 samples.

Materials

(See materials for Lab 1.1)

ingredient mL per rxn x 26 rxn x 19 pairs
DEB 0.6 15.6 296.4
KOAc 0.25 6.5 123.5
Isoprop 0.6 15.6 296.4
70% EtOH 1.4 36.4 691.6
T10E5 0.225 5.85 111.15
NaOAc 0.025 0.65 12.35
100%EtOH 0.5 13 247
T10E1 0.05 1.3 24.7

Put out 3 double block dry baths at 65C

salkprimerlabels2013.doc
lab3-4-redo.docx
lab_3-4-leafsquish.docx
2015-phire-genotyping.docx

3.4 - Phire Plant kit

3.4 - Phire Plant kit kdorfman Tue, 03/21/2017 - 18:43

Phire Plant Direct PCR Kit

Fisher F-130WH

Per plant sample:

  • 20 uL Dilution Buffer

Per 20 uL reaction:

  • 10 uL 2X Phire Plant PCR buffer
  • (primers to 0.5 uM)
  • 0.4 uL Phire hot start polymerase
  • 0.5 uL Plant squish supernate
  • sterile water to make 20 uL

Lab 3.4 2012

Lab 3.4 2012 kdorfman Tue, 03/26/2013 - 15:55

M 3/26/12

CORRECT THE VOLUMES IN THE LAB MANUAL 21 mL 10X in 210 mL total!

Goal for this lab: Genotype Salk line plants, looking for homozygous mutants.

Use 3 primers in a single reaction (GSP1, GSP2, LBP)

LB 195 LBb1.3 ATTTTGCCGATTTCGGAAC (111 bp from left border)

Materials

  • PCR strip tubes
  • Harris cutting mat
  • Harris Uni-Core (0.5 mm) Cutting Tool
  • Beakers for bleach

Reagents

  • 2% bleach (12 mL bleach + 588 mL dH2O)
  • 5U/µL Taq (3.5 µL per pair)
  • 10X polymerase buffer (21 + 21 = 42 µL per pair)
  • 2.5 mM dNTP mix (51 µL per pair)
  • Sterile dH2O
  • Working stocks of primers, including LBP diluted to 10 µM (17µL/rxn)

leaf squish calcs

leaf squish calcs kdorfman Thu, 03/28/2013 - 20:34
Forrxns/pair, & pairs
aliquotmL DEB /pair, & mL total
aliquotmL KOAc/pair, & mL total
aliquotmL isopropyl/pair, & mL total
aliquotmL 70% EtOH/pair, & mL total
aliquotmL T10E5/pair, & mL total
aliquotmL NaOAc/pair, & mL total
aliquotmL 100% EtOH/pair, & mL total
aliquotmL T10E1/pair, & mL total

leaf_squish_calcs.txt

3.5 Salk genotypes

3.5 Salk genotypes margaret Wed, 11/16/2011 - 18:39

Identifying genotypes of Salk-line plants: Analysis

Goal for this lab: Determine the genotypes of Salk line plants to identify homozygous mutant individuals. Run PCR reactions from 3.4 on gels

Students will have 28 + samples, so they need two gels.

Materials:

  • 2 2% agarose gels per pair
  • 1× TAE running buffer (no EtBr)
  • Loading dye (2µL/lane)
  • Fermentas MassRulerTM DNA ladder, low range (5µL/gel)

4. Bioinformatics

4. Bioinformatics margaret Wed, 11/16/2011 - 18:40

4.1 Basic Local Alignment Tool (BLAST) W 3/07/12

4.2 Library Research M 3/12/12

4.3 Representing Sequence Similarity Data W 3/14/12

5.1 - 5.3 expression

5.1 - 5.3 expression kdorfman Tue, 12/20/2011 - 19:45

5.1 Microarray resources M 4/2/12

MAKE SURE GENEVESTIGATOR ACCOUNT IS ACTIVE!!

5.2 Statistical analysis of microarray data W 4/4/12

Tell students what chemicals are available

  • ABA (2014)
  • ammonium nitrate
  • 1aminocyclopropanecarboxylic acid (converts to ethylene) (dry and frozen stock)
  • kinetin
  • giberellic acid
  • salicylic acid
  • IAA (dry and frozen stock) Indole-acetic acid
  • chitin (dry) (to mimic fungus attack)
  • lots of inorganic salts

http://www.phytotechlab.com/searchresult.aspx?categoryid=10

http://www.plantmedia.com/categories/3_43_288_691/Tissue-Culture-Hormon…

paper on germination in salt: http://www.researchgate.net/publication/255710805_The_effect_of_salt_st…

5.3 RT-PCR Planning M 4/9/12

  • 2-week old seedlings on plates - 2 plates per group (plates to refrigerator F 3/23, to growth chamber M 3/26)

  • 1-week old seedlings on plates 1 - 2 plates per group (for transfer experiments) (plates to refrigerator 3/30, to growth chamber 4/2)

  • 10 microfuge tubes with sterile, imbibed seeds in small batches for germination experiments (enough in each tube for one plate) (4/6)

  • 1 L MS in 100 mL aliquots for students to pour plates and add drugs or hormones, etc.)

  1. See planting schedule ↩︎

fisheruploadoligosfor_qpcr_2013_0.xls

2014 projects

2014 projects kdorfman Thu, 04/10/2014 - 21:27

RPR

4 MS plates plain
4 MS plates + final conc 140 mM NaCl

CTH

Salicylic acid in EtOH

Dilute into tween20 in water

Spray on plants

TVZ

Colloidal solution of chitin

mortar and pestle

CCM

Spray plants with Salicylic acid. see CTH.

MOH

damaged roots vs intact roots

plates

BHK

seeds

germination wet vs dry

WRD

light vs dark

NAL

CVM

KCl

5.4 RNA Extraction

5.4 RNA Extraction margaret Wed, 11/16/2011 - 18:32

Need a housekeeping gene

Need a better way to estimate RNA concentration. Forgo spectrophotometer? Just do gel? Get RNA ladder? Or is an estimate (or fold-difference) sufficient to get comparable amounts of RNA into each RT reaction? The absolute amounts don't really matter, do they?

Nanodrop? calibrate once with water (1 min very fast.) sample. type in name. 1.7 µL sample, run.

Replicates? allow 4 per group instead of 2? Require groups with same gene to work together? Either RNA extraction or RT is too touchy - if they had more replicates, would they be more likely to get usable data?

Stay only in the 3` end. You seldom get a full size transcript. Add this to the criteria for primer design.

2015

  • Use ball mill to grind samples
  • Re calculate for up to 9 extractions per group

W 4/11/12

Prepare total RNA from selected Arabidopsis tissues and accurately quantify RNA concentration and yield.

Equipment:

  • Balance + small weigh boats
  • Liquid nitrogen & ice buckets
  • Blue pestles1 & matching tubes (individually wrapped in kits drawer)
  • 2 Lilac and 2 pink tubes from the RNEasy2 kit
  • 8 2mL collection tubes (from kit)
  • 2 capless 2 mL tubes, sterilized
  • brand-new, untouched tips (with warning labels: RNAse free! Gloves only!)
  • brand-new, untouched microfuge tubes (with warning labels)

Reagents

One tube for each group (2 per group of RPE), plus 5 to have on hand

  • 1 mL RLT (450 µL x 2)
  • 1 mL 100% ethanol (225 µL x 2)
  • 1.5 mL RW1 (350 µL x 4)
  • 200 µL RDD (70 µL x 2)
  • 10 µL DNase3 aliquot all of it, freeze. Label tube “10µL DNase”
  • 3 mL RPE (500 x 4) 2 tubes per group, each 1.5 mL
  • 200 µL RNase-free H2O (50 + 10 + 5 µL)
  • 1.5 mL TrisHCl 10 mM pH 7.5 (90 + 100 µL) freshly filtered
  • 100 µL new loading dye (i.e., not contaminated with RNase) (The loading dye that comes with Fermentas ladders is good)

Follow kit instructions for adding β-M-EtOH

1.0% agarose – enough for 12 groups + 2 accidents

HMW ladder. remove the LMW ladder from their boxes; replace with HMW (in Fermentas box in freezer)

Full carboy of 1X TAE

Remove anything that might be contaminated with RNAse, e.g.

  • water
  • dilution buffer
  • Loading dye
  • Opened tips and tubes containers

Order the DNase separately. Qiagen 79254.

The kit comes with RNase-free water and RDD for diluting the DNAse

To program the Spectrophotometer:

  • Main Menu
    • RNA
    • Setup
    • Dilution 0010 (µL RNA) + 0090 (µL diluent)
    • Factor 40
    • Units µg/mL
    • Resolution= 0.001 (max)
    • λ (wavelength) = 260

Save RNA samples in the -80!

  1. Disposable Pellet Pestle without microtubes; 1.5mL K749521-1500 Kimble Chase Kontes Case of 100 for $54.74 ↩︎

  2. RNeasy Plant Mini Kit (50) Qiagen 74904 ↩︎

  3. DNase I Qiagen 79254 http://www.qiagen.com/products/accessories/rnase-freednaseset.aspx
    Inject 550µL RNAse-free water into the DNAse vial. Make 10 µL aliquots. Need ~48 labels. Freeze. Give away the excess. Can extend slightly by adding 575 µL to get 57 aliquots per vial instead of 55. ↩︎

5.5 RT-PCR

5.5 RT-PCR margaret Wed, 11/16/2011 - 18:14

Alternate kit to try AzuraQuant cDNA synthesis kit 25 rxns $89; 100 rxns $299

** Should this be done in the thermocycler?**

Prepare cDNA, and use it as a template for RT-PCR.

4 RT reactions: For each RNA sample (two tissues or two conditions): one +RT and one RT

2015

  • Each group can do up to 9 rxns (3x3x3), with some doing 8 (2x4) or as few ask 6 (2x3). This way there will be replicates

  • We will give them 12 cDNA's (2 tissues x 2 conditions x 3 replicates)

  • 9 rxns x 19 groups + 12 salt rxns by the TA's = 183. Buy 4 50-rxn RNEasy kits from Qiagen

Equipment

  • Hot blocks at
    • 50°C (2 dry baths - this is the long step and there are at least 4x as many tubes as groups),
    • 65°C
    • 70°C

RT Reagents

  • 1 tube per group + 5 extra = 15 tubes of each reagent (except RNaseOUT & superscript)

  • dispense

µL per group reagent actual need (µL) 15 aliquots (µL) notes
8 Oligo dT 50 µM 1 1 x 4 120
8 10 mM dNTP mix 2 1 X 4 120
60 RNAse-free water 13 x 4 900 aliquot once for both RT and qPCR
20 5X 1st strand buffer 4 x 4 300 comes with Superscript
8 0.1M DTT 1 x 4 120 comes with Superscript
(4 ) RNaseOUT 3 1 x 4 60 Dispensed from freezer box during lab
(2 ) superscript III 4 1 x 2, 30 dispensed from freezer box during lab

PCR Reagents

1 tube per group + 5 extra (except Taq and primers) dispense per group actual need

µL per group reagent actual need (µL) 15 aliquots (µL) notes
550 Sterile ddH2O 360 8250
75 10× Ex-Taq Buffer 50 1275
50 2.5 mM dNTP Mix 40 850
15 GSP1 12.5 μM 10 check their supply (or ask at the beginning of class)
15 GSP2 12.5 μM 10 check their supply (or ask at the beginning of class)
2 cDNA +/- Fe, each 2 30 dispense during lab
10 Ex-Taq Polymerase 1U/μL 10 150 dispensed during lab - can dilute to 0.8U/µL

  1. Fisher FERSO131 Oligo dT 100 µM (=0.5µg/µL) 60 µL @ ~$50. Dilute to 50µM!! (for emergencies: 50 µM oligo(dT) Fisher stockroom: C1101 0.5µg/µL x 40µL = 20µg) - Order T(18) from Invitrogen??? ↩︎

  2. 14 µL each + 84 µL RNase-free water OR Fisher FERR0192 ↩︎

  3. Invitrogen 10777019 RNAse out 5KU @ $143 ↩︎

  4. superscript III 200U/µL Invitrogen 18080044 10KU @ $259 ↩︎

rnase_out.pdf
superscriptiii_man.pdf

RT calcs

RT calcs kdorfman Tue, 04/22/2014 - 16:55
Forpairs andreactions per pair
Reagent rxn volume aliquot volume total volume

5.6 RT-PCR analysis

5.6 RT-PCR analysis margaret Wed, 11/16/2011 - 18:37

Make enough for 2 gels/pair 1.5% agarose

gels mL TAE g agarose µL EtBr
11 550 8.25 5.5
20 1000 15 10
22 1100 16.5 11
24 1200 18 12

Use EtBr TAE

Use LMW mass ruler

  • Prepare 15 μL of each of your PCR reactions for loading on gels by transferring to a clean, labeled 1.5 mL microfuge tube, and adding 3 μL of loading dye. Load the entire 18 μL – it is important that all lanes contain the same amount.

  • Load gels, and run at 100V for 45 minutes. Remember to load 5 μL (= 220 ng) of LMW Mass Ladder as your standard.

  • Analyze gels

5.6 qPCR

5.6 qPCR kdorfman Fri, 04/19/2013 - 17:05

Q-PCR after RT

Housekeeping gene:

Gene At5g25760 (Ubiquitin Congugating enzyme 21) UBC21

Forward primer TCTCTCTCTCTCTCTCTCGCTCTC Reverse Primer TGATGCCTGCATCTCTAATTTCCC

Re-think the need to have exactly the same amount of RNA in each cDNA reaction.

Set up reactions in ISB. Use Qiagen 204054

Load reactions and take to Sam's lab.

Eppendorf Realplex2 Master Cycler

Reaction set up

component µL/rxn aliquot for 16 rxns
2x quantifast SYBR Green PCR master mix 10 176
qPCR forward primer 10 µM 1 32
qPCR reverse primer 10 µM 1 32
Template cDNA 1 -
RNAse free water 7 (use H2O from RT)
------------------------------------------------ ---- -----
Total 20

qPCR Settings

File - New Assay

plate layout:

Filter: SYBR

Sample volume: 20

Probe: SYBR

Filter: N/A

Background: spec background

Highlight the wells you want to detect. Label as unknowns.

PCR Program:

Step Temp Time
PCR initial heat activation 95 2 min
Denaturation 95 15 sec
Primer annealing 55 15 sec
Extension 68 20 sec

Save the assay.

Press run (green arrow icon).

Plates: USA Scientific 1402-9500

Sealing film: 2921-0010

qpcr-primer-labels-2013.doc
qpcr2013.docx
ct_values_from_qpcr_experiments-gg_2014tuth.docx
gg_mw_qpcr-1.xls
2015_tuth_qpcr_results.xlsx
gga_mw_s2015qpcr.xlsx
sandra_ubi_1_12_nov30_2015.xls

Arabidopsis resources

Arabidopsis resources kdorfman Fri, 07/10/2020 - 18:06

Arabidopsis germination

HDPE anti-aphid mesh for hydroponics, mesh size ~35.
Anti-aphid mesh with a 0.75 mm by 0.75 mm opening size (mesh usually named 25 × 25) is adequate for keeping Arabidopsis seeds on top of the mesh

See technique here

developmental timeline

PCR Calcs

PCR Calcs kdorfman Mon, 04/01/2013 - 20:56

From Takara Ex Taq recipe

For PCR reactions
at µL per reaction
addµL 10X Ex Taq buffer
addµL dNTP 2.5 mM
addµL forward primer 12.5 µM
addµL reverse primer 12.5 µM
addµL template DNA (~250 ng/µL)
addµL water to final volume
addµL ExTaq 1U/µL
for a final volume ofµL

pcrcalcs.xls
TaKaRa ExTaq manual

Readings & on-line resources

Readings & on-line resources kdorfman Thu, 05/08/2014 - 15:59

Molecular Genetics information

Cold Spring Harbor DNA Learning Center

DNA from the Beginning

The New Genetics (on-line text)

NCBI Handbook glossary

GeneReviews Illustrated Glossary

qPCR

PCR

Human Molecular Genetics, 2nd ed

Sequence - Evolution- Function (2003)

Gene Ed (NLM NIH)

Gene Ed Biotechnology

Brown (2002) Studying the transcriptome

Brown (2002): genomes, transcriptomes and proteomes

Brown (2002) Understanding a Genome Sequence

Brown (2002) Studying DNA

Brown (2002) Nucleases

Brown (2002) DNA microarrays and chips

Arabidopsis specific material

"About Arabidopsis" at TAIR

The Arabidopsis Book - open access journal at TAIR

T-DNA as an insertional mutagen in Arabidopsis

link title

link title

link title

link title

link title

link title

link title