Gene & Genome

Arabidopsis germination

G&GA calendar

isbbiology at gmail dot com

HDPE anti-aphid mesh for hydroponics, mesh size ~35.
Anti-aphid mesh with a 0.75 mm by 0.75 mm opening size (mesh usually named 25 × 25) is adequate for keeping Arabidopsis seeds on top of the mesh

See technique here

developmental timeline

Buy hormones for 2015Fall

2,3,5-Triiodobenzoic acid

ABA

jasmonic acid

1-N-Naphthylphthalmic acid

2012 schedule

day date Lab # title
M 1/23 0.1 micro-mixology
W 1/25 1.1 DNA extraction
M 1/30 1.2 DNA quantification
W 2/1 0.2 Intro to Wiki (computer)
M 2/6 2.1 Initial working map (computer) (Timo gone)
W 2/8 2.2 Finalizing gene models (computer) (Timo gone)
M 2/13 2.3 Choosing PCR primers (computer) (Timo gone)
W 2/15 2.4 Testing PCR conditions (Timo gone)
M 2/20 no lab President's Day
W 2/22 2.5 Restriction Mapping
M 2/27 3.1 Identifying t-DNA insertion sites (computer) (Sam gone)
W 2/29 0.3 Arabidopsis essentials (364) (Sam gone)
3.2 Salk line genetics (computer)
M 3/5 3.3 Phenotype testing of Salk mutants
W 3/7 4.1 BLAST (computer)
M 3/12 4.2 Library research (computer)
W 3/14 4.3 Representing sequence similarity data (computer)
M 3/19 no lab spring break
M 3/26 3.4 Leaf squish and PCR
W 3/28 3.5 Identifying genotypes of Salk-line plants
M 4/2 5.1 Microarray resources (computer) (Sam gone)
W 4/4 5.2 Statistical analysis of microarray data (computer) (Sam gone)
M 4/9 5.3 RT-PCR planning
W 4/11 5.4 RNA extraction & purification
Tu 4/17 5.5 (Monday schedule) RT-PCR
W 4/18 5.6 Analysis of RT-PCR reactions
M 4/23 Work on Wiki (catch-up day?) (computer)
W 4/25 presentations I
M 4/30 presentations II

Course Prep

AttachmentSize
spot_labels_gga.docx111.85 KB

2013 genes

AttachmentSize
unknowns_table_2013.xls50 KB
gga383h_group_gene_assingments.xls22 KB

2015 rosters, etc.

AttachmentSize
2015f_drawer_labels.doc36.5 KB
group_names.docx60.99 KB
mw_placemats.docx52.17 KB
tt_placemats.docx49.92 KB

Enzymes & kits

  • Takara Ex-Taq
    giant economy size: RR001B 4x 250U $590 at Clontech
    $843 at Fisher


Fisher equivalent has this buffer: Tris-HCl 100mM, pH 9, KCl 500 mM, MgCl2 15 mM. Takara buffer is 20 mM MgCl2

  • try this? cheap Taq at http://www.bulldog-bio.com/bioreadyrtaq.html

  • Invitrogen 18080044 superscript III 200U/µL 10KU @ $259

  • Invitrogen 10777019 RNAse out 5KU @ $143

  • Invitrogen RNAse A Check supply.

  • Qiagen 79254 DNAse
    includes RNase-free water and RDD for diluting the DNAse

  • Qiagin RNEasy 74904

    • if needed RW1 1053394
    • if needed RLT 79216
  • Quantifast 204054 400 rxns for q pcr

  • Zymo Clean & Concentrator kit

  • Oligo-dT Fisher FERSO131 Oligo dT 100 µM 60 µL @ ~$50. Dilute to 50µM!! (for emergencies: 50 µM oligo(dT) Fisher stockroom: C1101 0.5µg/µL x 40µL = 20µg)

link title

AttachmentSize
en-rnase-free-dnase-set-handbook.pdf52.85 KB

2015 (S) Restriction list

Enzyme Cut Smart NEB 1 NEB 2 NEB 3 NEB 4
Aat2 100 10 50 50
Acc651 25 10 75 100
Acl1 100 10 10 10
AflII 100 50 100 10
Age1[^1] 75 100 75 25
AlwN1 100 10 100 50
Apal1 100 100 100 10
Asc1 100 10 10 10
Ava1 100 10 100 25
Ava2 100 50 75 10
BamH1-HF 100 100 50 10
BciVI 100 100 25 10
Bgl2 10 10 10 100
BmgB1 10 10 10 100
BsaI 100 75 75 100
BspD1 100 25 75 50
BspE1 10 10 10 100
BsrB1 100 50 100 100
BsrG1 25 25 100 100
Cla1 100 10 50 50
Dra1 100 75 75 50
Eag1 10 10 25 100
Ear1 100 50 10 10
EcoR1 50 25 100 50
EcoRV-HF 100 25 100 100
HaeIII 100 50 100 25
Hha1 100 25 100 100
Hind3 50 25 100 50
Hind3 50 25 100 50
HinP1I 100 100 100 100
Hpa1 100 10 75 25
Hpa2 100 100 50 10
Kas1 100 50 100 50
Mbo1 100 75 100 100
Mlu1 25 10 50 100
Msp1 100 75 100 50
Nae1 100 25 25 10
Nco1 100 100 100 100
Nde1 100 75 100 100
Nhe1-HF 100 100 25 10
Pst1 50 75 75 100
Pvu1 10 10 25 100
Pvu2 100 50 100 100
Rsa1 100 25 50 10
Sac1 100 100 50 10
Sac2 100 10 100 10
Sal1 10 10 10 100
Sau3A1 100 100 50 10
Sca1 NR NR NR 100
SexA1 100 100 75 50
Spe1 100 75 100 25
Sph1 100 100 100 50
SphI
SSpI
Sty1 10 10 25 100
Sty1-HF 100 25 100 25
Xba1 100 10 100 75
Xcm1 100 10 100 25
Xho1 100 75 100 100
Xma1 100 25 50 10

[^1] gone as of 9/16

AttachmentSize
re_gene_and_genome.xlsx37.19 KB
restriction_list_fa2016.xlsx33.97 KB

2017S Restriction list

Enzyme Cut Smart NEB 1 NEB 2 NEB 3 NEB 4
Aat2 100 10 50 50
Acc651 25 10 75 100
Aci1 100 10 25 100
Acl1 100 10 10 10
AflII 100 50 100 10
Age1 75 100 75 25
AlwN1 100 10 100 50
Apal1 100 100 100 10
Asc1 100 10 10 10
Ava1 100 10 100 25
Ava2 100 50 75 10
BamHI-HF 100 100 50 10
BciVI 100 100 25 10
Bgl2 10 10 10 100
BmgB1 10 10 10 100
BmsAI 100 50 100 100
BsaI 100 75 75 100
BspD1 100 25 75 50
BspE1 10 10 10 100
BsrB1 100 50 100 100
BsrG1 25 25 100 100
Cla1 100 10 50 50
Dra1 100 75 75 50
Eag1 10 10 25 100
Ear1 100 50 10 10
EcoR1 50 25 100 50
EcoRV-HF 100 25 100 100
HaeIII 100 50 100 25
Hha1 100 25 100 100
Hind3 50 25 100 50
Hind3 HF 100 10 100 10
HinP1I 100 100 100 100
Hpa1 100 10 75 25
Hpa2 100 100 50 10
Kas1 100 50 100 50
KpnI-HF 100 100 25 10
Mbo1 100 75 100 100
Mlu1 25 10 50 100
Msp1 100 75 100 50
Nae1 100 25 25 10
Nco1 100 100 100 100
Nde1 100 75 100 100
Nhe1-HF 100 100 25 10
Pst1 50 75 75 100
Pvu1 10 10 25 100
Pvu2 100 50 100 100
Rsa1 100 25 50 10
Sac1 100 100 50 10
Sal1 10 10 10 100
Sau3A1 100 100 50 10
Sca1 NR NR NR 100
SexA1 100 100 75 50
Sma1 100 10 10 10
Spe1 100 75 100 25
Sph1 100 100 100 50
SSpI 50 50 100 50
Sty1 10 10 25 100
Sty1-HF 100 25 100 25
Xba1 100 10 100 75
Xcm1 100 10 100 25
Xho1 100 75 100 100

G&GA solutions

Make solutions (Check supplies first)

See stock solution recipes


Aliquot:

Solution vol aliquots/pair total aliquots for Labs
T10E1 1 mL 5 50 1.1, 1.2, 2.4, 3.3
T10E5 0.75 mL 2 20 1.1
EtOH 95% 1.5 mL 2.2 22 1.1, 5.4
EtOH 70% 7.5 mL 1.2 12 1.1
isopropyl 7.5 mL 1.2 12 1.1
NaOAc 100 µL 1.2 12 1.1
KOAc 5 mL 1.2 12 1.1
DEB 10 mL 1.2 12 1.1
Tris pH 7.5 10 mM 1.5 mL 3 30 1.2, 5.4
loading dye 50 µL 1.5 15 1.2, 2.4, 2.5, 3.4, 5.4, 5.6
HMW std 15 µL 1.2 12 1.2
dNTP 2.5 mM 150 µL 1.5 15
sterile H2O 1 mL 6 60 2.4, 2.5, 3.3, 5.5
LMW std 50 µL 1.5 15 2.4, 2.5, 3.4, 5.4, 5.6
AttachmentSize
fermentas_calcs.xls22 KB

solutions calcs

Forpairs
Reagent vol/aliquot aliquots/pr tot aliquots total vol
T10E1 mL
T10E5 mL
EtOH 95% mL
Isopropyl mL
NaOAc mL
KOAc mL
Loading dye mL
Mass ruler mix mL
dNTP 2.5 mM mL
Sterile water mL
Tris pH 7.5 10 mM mL

AttachmentSize
solutions_calc_template.txt1.22 KB

G&GA stations

Each Station should have the following items:

Top Drawer

  • 2 gel rigs
  • 2 gel trays
  • 2 pencils
  • 1 alcohol-resistant marker, not Sharpie
  • 1 scissors
  • 1 forceps
  • 1 roll label tape
  • 3 micropipettors: 20μL, 200μL, 1000μL
  • 3 boxes pipet tips: 20μL, 200μL, 1000μL
  • spatula
  • funnel
  • 1 package 10 mL pipettes
  • 1 10mL pipet filler
  • 2 microfuge racks
  • 2 test-tube racks
  • scotch tape
  • ruler
  • timer

Second Drawer

  • 2 250 mL flasks
  • 1 1L beaker of microfuge tubes
  • 1 freezer box

Third Drawer

  • 2 gel casting trays
  • 2 levels
  • 2 15-well combs
  • 2 8-well combs

Each bench should have the following to be shared:

  • 1 waste beaker
  • ice bucket
  • 1 box Kimwipes
  • microfuge
  • DNA Engine Thermocycler
  • Dissecting microscope
  • Parafilm
  • 3 boxes gloves: sm, med, lg
  • Biology of Plants by Peter Raven

Planting guide

Check seed stocks before planting - some germinate better than others!!

Hydroponics video: https://www.youtube.com/watch?v=c9neVLaS63c

Hydroponics paper: http://www.plantmethods.com/content/9/1/4

2012 Schedule

Potting on soil

date wks before Lab purpose per pot pots/pair # pots
1/4 8 0.3 demo 3-5 1 10
1/11 7 0.3 demo 3-5 1 10
3 1.1 DNA lots! 4 40
1/18 6 0.3 demo 3-5 1 10
2 1.1 DNA lots! 4 40
1/25 5 0.3 demo 3-5 1 10
2/1 4 0.3 demo 3-5 1 10
2/8 3 0.3 demo 3-5 1 10
2/15 2 0.3 demo 3-5 1 10
2/27 6 5.3 projects 3-5 1 10
3/6 5 5.3 projects 3-5 1 10
3/13 4 5.3 projects 3-5 1 10
3/20 3 5.3 projects 3-5 1 10
3/27 2 5.3 projects 3-5 1 10

Planting on plates

date for Lab purpose # plates notes
2/22 0.3 demo 10 1 weeks before lab
3/26 5.3 projects 10 2 weeks before lab
4/3 5.3 projects 10 1 weeks before lab
AttachmentSize
2012_monthly_sun_us_holidays_landscape.doc332.46 KB

Calendar Spring 2012

January 2012

Sun Mon Tue Wed Thurs Fri Sat
1 Holiday 2 3 4 Plant 5 6 7
8 9 10 11 Plant 12 13 14
15 16 Holiday 17 18 Plant 19 20 21
22 23 24 25 Plant 26 27 28
29 30 31


February 2012

Sun Mon Tue Wed Thurs Fri Sat
1 Plant 2 3 4
5 6 7 8 Plant 9 10 11
12 13 14 15 Plant 16 17 18
19 20 Holiday 21 22 23 24 25
26 27 Plant 28 29


March 2012

Sun Mon Tue Wed Thurs Fri Sat
1 2 3
4 5 6 Plant 7 8 9 10
11 12 13 Plant 14 15 16 17 Spring Break
18 19 20 Plant 21 22 23 24
25 26 27 Plant 28 29 30 31


April 2012

Sun Mon Tue Wed Thurs Fri Sat
1 2 3 4 5 6 7
8 9 10 11 12 13 14
15 16 Holiday 17 (Mon) 18 19 20 21
22 23 24 25 26 27 28
29 30


May 2012

Sun Mon Tue Wed Thurs Fri Sat
1 Last day 2 3 4 5
6 7 8 9 10 11 12
13 14 15 Grades due 16 17 18 19
20 21 22 23 24 25 26
27 28 Holiday 29 30 31

On plates

Planting on Plates

Make MS plates: http://wahoo.nsm.umass.edu/content/ms-plates

  • To get weakling mutants started before potting in soil
  • Or to plant seeds on specified media
  • Or to see roots

Seed Preparation

  • Put appropriate number of seeds in a sterile microfuge tube
  • Sterilize with EtOH (or sterilize with bleach – see below)
  • Sterilize filter paper with EtOH, let dry in sterile hood (can set it on top of an open sterile petri plate cover
  • Add 95% EtOH to seeds for 5 min, dump seeds onto filter paper
  • let dry, tap onto agar
  • Make a line of seeds in agarose above the midline of the plate:
  • Tape plates with Micropore surgical tape
  • Refrigerate the plates for 2 days
  • Move plates to growth chamber
  • Stand plates on edge under the lights. Tape several together.

OR Sterilize with bleach solution

  • Add ~1mL of bleach solution to each tube
  • Cap and shake
  • Leave tube on its side for 20-30 min, shaking periodically
  • Put upright after last shake (so seeds settle)
  • In laminar flow hood
    • Use a pipetman that has been sprayed with ethanol and air-dried in the hood
    • Remove as much bleach solution as possible from the tube
    • Add ~1 mL sterile ddH2O, mix and let seeds settle again
    • Do at least 4 washes, to dilute out the bleach
    • Add ~1mL sterile 0.1% agarose (so seeds will be suspended in the liquid)

Bleach solution for sterilizing seeds

  • 7 mL sterile ddH2O (must be freshly made!)
  • 3 mL Chlorox
  • 1 uL Triton X-100 (detergent to help get bleach into seed crevices)

0.1% agarose for plating seeds

  • 100 mL sterile ddH2O
  • 0.1 g agarose . autoclave to melt; shake bottle after autoclaving

On soil

Arabidopsis planting guide - Plants on soil

Routine weekly planting to produce plant material for observation or DNA extraction

  • Pots
    • 6 pots in a big flat with no holes
    • fill with clump-free potting soil, leaving some space at the rim
  • Treat with Gnatrol for fungus gnats
    • saturate with hot water the night before Teddi comes
    • Arrange for Teddi to do Gnatrol treatment
  • OR Heat in oven
    • pre-heat oven to 225F (=~107C)
    • Put soil-filled pots in aluminum lasagne pan
    • Cover with foil
    • insert thermometer in one pot near center
    • Heat to 180F (=~82C)
    • leave in oven for 30 min.
    • leave covered until ready to plant
  • Seeds for DNA
    • Start a set 4 weeks before needed, another set 3 weeks before
    • Columbia wild type (col-0)
    • Scatter seeds on surface of soil (remoisten before if it is dry)
    • Put on plastic cover
    • Put in refrigerator, keep dark (this synchronizes germination)
    • Transfer to growth chamber on the third day
    • If no room in fridge, put seeds in microfuge tube, add water, refrigerate in dark 2 days, then plant
  • Seeds for demo or experimental plants
    • Put seeds in microfuge tube, water, refrigerate, keep dark
    • 3rd day: pour into small beaker, add more water
    • Deposit one seed to each corner of the pot, plus one in the middle with a transfer pipet.
    • Transfer to growth chamber
  • Growth Chamber
    • 22C, 16H light, schedule continuous program
    • Water bottom flat ~3x per week
    • Remove cover after plants are well established.

hydroponics

http://www.plantmethods.com/content/9/1/4

http://www.bio-world.com/productinfo/3_44_292/124429/Magenta-GA-Plant-Cu...

2015 attempt

  • Make 1x MS, pH to 5.6

  • Split: most as growth medium, a little bit for 0.7% agar (err on the low end), sterilize

  • Cut lids off microfuge tubes, poke a hole in each, sterilize in a beaker

  • line lids up, flat side down, on a strip of scotch tape

  • fill with 0.7% agar.

  • put lids into floatie or other rack.

  • put 1 sterilized seed in each hole. (in 0.1% agar)

  • Wrap with saran wrap

  • Cover tightly with foil, stratify in refrigerator for 2-3 days

  • Remove foil, put container in growth chamber at 16h day, 22C

  • Transfer lid to 50 mL tube with hole drilled in it at ~3 weeks.

  • Aerate or stir medium

cDNA

*

cDNA 2010

*Making cDNA +Fe & -Fe roots and shoots**

20 MS plates, heavily sown with At Col0 seeds.

At 7 days, transplant all seedlings, half to MS plates, half to –Fe plates.

After 3 more days, harvest roots, shoots. 12 samples in all.

(In future, plant 4 full plates per root sample)

Use razor blade to amputate roots

Grind in ceramic mortar and pestle (bake 1st overnight!)

Extract RNA, following lab manual protocol.

From 5/7/10:

Sample ng RNA/uL uL to get 200 ng uL to get 44.5 ng H2O to 5 uL
R+1 23.84 8.39 1.87 3.13
R+2 95 2.11 0.47 4.53
R+3 24.5 8.16 1.82 3.18
S+1 67.35 2.97 0.66 4.34
S+2 32 6.25 1.39 3.61
S+3 73.6 2.72 0.60 4.40
R-1 9.5 21.05 4.68 0.32
R-2 8.9 22.47 5.00 0.00
R-3 18 11.11 2.47 2.53
S-1 98.75 2.03 0.45 4.55
S-2 76.45 2.62 0.58 4.42
S-3 79.05 2.53 0.56 4.44

max ng in most dilute sample= 44.50

Can’t get 200 ng RNA in less than 5 µL in several samples.

Calculate the amount of RNA in 5 µL of the most dilute sample (-R2), calculate the µL of each sample required to get that amount. Add water to 5 µL.

Run on gel. R-3 was calculated wrong (or it degraded).

Initial spec reading was 6.3; reblanked and got 18. Maybe the 6.3 was right?

Gel:

Lane 1 2 3 4 5 6 7 8 9 10 11 12 13
HMW std R+1 R+2 R+3 S+1 S+2 S+3 R-1 R-2 R-3 S-1 S-2 S-3

Freeze the RNA.

Two choices for cDNA:
* omit R-3 (calculate amount of RNA from next most dilute, -R 2), * or recalculate R-3 from the initial 6.3 reading

From –R2: 11 µL contains 97.9 ng of RNA, almost 10% of the recommended amount.

Can run 11 RTPCR reactions, and only have 40 µL of R- samples, but 60 µL of all of the others.

From –R3 at 6.3ng/µL: 11 µL contains 69.3 ng, which is only 7% of the recommended amount.

Combine the 3 of each type into a single tube. Measure volume:

ingredient R- R+ S- S+
uL RNA 102 111 111 111
+ 1/10 vol 3M NaOAc 1 10.2 11.1 11.1 11.1
+ 2 vol EtOH 204 222 222 222

Freeze 20 min

Spin 10 min

Remove supernate

Add 70% EtOH

Spin again (R pellets hard to see)

Remove all liquid. Add:

ingredient R- R+ S- S+
1/4 vol RNAse-free H2O 25.5 27.75 27.75 27.75
spec ng/uL: 118.2 116.5 282.4 203

11 µL of least conc has 1281.5 ng

ingredient R- R+ S- S+
uL RNA 10.84 11 4.53 6.31
water 0.16 0 6.49 4.69

Proceed with RT, following lab manual protocol.

Run gel (1st one failed – pic is second run)

LMW 1/50 1/100 R+ S+ R- S- std gDNA gDNA

Complete waste of time and resources!

Test the cDNA with PCR

Test cDNA with oMZG_RT_L and oMZG_RT_R

(The primer names in the Wiki are oMZG_T_R and oMZG_T_L; in the freezer, there is oMZG_RT_L and oMZG_RT_R)

gDNA product is 482bp, cDNA is 362 (with some alternative splicing products in between).

Master Mix for 7 rxns (1/50 gDNA, 1/100 gDNA, R+, S+, R-, S-) + 1

ingredient per rxn per 7 rxns

water 36 252

10X buffer 5 35

2.5mM dNTP 4 28

oMZG_RT_L 1 7

oMZG_RT_R 1 7 T aq 1 7

Each rxn: 48 µL master mix + 2 µL template

Make 1/50 gDNA: 1 µL gDNA + 49 µL water

Make 1/100 gDNA: 10 µL 1/50 DNA + 10 µL water

Tube # 1 2 3 4 5 6 Sample 1/50 gDNA 1/100 gDNA R+ S+ R- S-


  1. make fresh, pH 7.0, filter sterilize 

cDNA 2013

Make cDNA Summer 2013

Summary:

12 samples, 3 replicates of each treatment:

MS -> MS MS -> -Fe
shoots numbers 1-3 numbers 7-9
roots numbers 4-6 numbers 10-12

cDNA in 12 labeled tubes in freezer in 362 (each made with 1 µg RNA, using superscript III)

RNA in box in -80 in 262

number plant part Fe ng/µL µL RNA/1µg
1 shoot Fe+ 125.9 7.94
2 shoot Fe+ 328.5 3.04
3 shoot Fe+ 259.2 3.86
4 root Fe+ 318.1 3.14
5 root Fe+ 429.5 2.33
6 root Fe+ 282.6 3.54
7 shoot Fe- 883.7 1.13
8 shoot Fe- 427.9 2.34
9 shoot Fe- 432.4 2.31
10 root Fe- 224.3 4.46
11 root Fe- 258.8 3.86
12 root Fe- 139.9 7.15

sterilize seeds

  • sterilize seeds in 0.5 mL 70% EtOH, 0.05% TritonX-100, ~3 min, mild agitation.

  • Let seeds settle, remove liquid

  • Replace with sterile water, 3X

  • Replace water with sterile 0.1% agar, 3X

  • plate heavily in a line on flattened cellophane (wet it if necessary)

  • stack plates flat

  • cover in foil, refrigerate, 48 hours

test platforms

Try different porous platforms for seedling growth

Get samples from Magdalena's lab

Sterilize between sheets of filter paper in a glass petri dish.

  • Moss cellophane

  • Roll cellophane

  • Magenta box screen

  • Sheer fabric

Seeds grow fine on flat cellophane. The roots have trouble getting over a bump or air bubble.

Seeds do not grow well on mesh fabric.

Wire screen does not lie flat on agar.

Put samples of each on MS agar

Iron experiment

Grow Col0 seeds to test effect of iron deprivation on gene expression

Make plates:

Sow sterile seeds on cellophane in 12 MS plates as heavily as possible.

After stratification,

  • 7 days in incubator

  • Transfer half to iron-free plates, half to MS plates

  • Harvest after 3 days

Extract RNA

Grind tissue

Grind roots +/-, shoots +/- in ball mill (Sam's Retch Mixer Mill MM400)

  • Precool the white block for the ball mill

  • prepare 2 2-mL tubes per plate (label tubes on side as well as top)

    • 3 roots + iron
    • 3 roots - iron
    • 3 shoots + iron
    • 3 shoots - iron
  • 2 metal beads per tube 3.2mm diameter ss beads (90g) - Cat. No. 11079132ss from www.biospec.com (Can also get from Fisher)

  • cool in LN2

  • Add tissue to cold tube, put back in LN2

  • Put all tubes in cold block

  • Shake 20 sec, check. The heat of shaking may start to defrost the tissue. Throw it back in the LN2. (Shake too long, and the cap may disintegrate!

  • Return to LN2

RNEasy

Prepare RNA from powdered frozen tissue

Use RNeasy Plant Mini Kit (50) Qiagen 74904

  1. Add 450 µL Buffer RLT. Mix vigorously. Spin down.

  2. Transfer lysate to lilac Qiashredder in 2mL collection tube

  3. Spin 2 min, full speed

  4. Transfer flow-through (NOT PELLET) to new tube. Toss the lilac column

  5. Add 225 µL 100% EtOH to lysate. Mix by pipetting up and down

  6. Transfer entire sample to pink spin column in a 2 mL collection tube.

  7. Discard flow-through. Keep column.

  8. Add 350 µL RW1 to column. Spin 15 sec, full speed.

  9. Discard flow-through. Keep column

  10. Add 70µL RDD to 10 µL DNAse I. BE GENTLE. Put the 80 µL on the column. Incubate at room temp 15 min.

  11. Add 350 µL RW1. Spin 15 sec. full speed.

  12. Discard flow-through, reuse collection tube.

  13. Add 500 µL RPE to column. spin full speed 2 min.

  14. Put column in new capless collection tube. Discard old collection tube.

  15. Spin 1 min, full speed

  16. Add 30 µL RNAse-free water to column membrane. Spin 1 min, full speed.

  17. Repeat, with 20 µL RNAse free water.

  18. Transfer all 50 µL RNA to clean, labeled tube. Keep on ice

Reagents

For RNEasy reactions
add: mL RLT
add: mL 100% EtOH
add: mL RW1
add: mL RDD
add: mL DNAse I
add: mL RPE
add: mL RNAse-free water

[RNA] by nano-drop

  1. Clean the pedestals
  2. Blank the machine

    1 µL buffer onto lower measurement pedestal

    F3 (Blank)

  3. Wipe again
  4. Test the blank:

    1 µL buffer

    F1 (Measure)

    if it's flat, you're good to go

  5. 1 µL sample. repeat.

RT

Make cDNA by reverse transcription

Calculate the volume of each sample required to get 1 µg RNA

For reactions
with ng/µL RNA
add: µL oligo(dT)
add: µL RNA
add: µL 10mM dNTP mix
add µL water (final vol = 13µL/rxn) 65 C 1 min, then ice. Spin down.
add: µL 5X 1st strand buffer
add: µL 0.1M DTT
add: µL RNAseOUT
add: µL Superscript III (200U/µL). 50C 45 min. Stop rxn: 70C 15 min

Note I bought the 10 µL Superscript, mixed it with some leftover, and had enough to do one reaction per RNA sample (=60 µL per treatment). Should have bought the bigger size.

I should use some of the remaining RNA to try out the RT sample I got from Qiagen. Maybe the best 8 RNA's.

AttachmentSize
rnagelsfeexpt.xls8.2 KB
rnamass.xls782 bytes
rna-for-fe-exp.jpeg512.21 KB
rna-for-fe-exp2.jpeg512.3 KB

0.1 Micro-mixology

Put out one set of 12 scintillation vials per 2 pairs of students.

Pour out anything that has gone cloudy.

Vortex to remix anything with paint.

To top up,

Use Google images to find color pictures of triple sec and sour mix to match the color.

Use white paint tint from Cowl's Lumber

Except for red wine, mix food coloring with water first, then dribble the dilute colored solution into water to the desired hue.

Add ethanol or sodium azide as a preservative to the glycerol-based solutions and the coffee creamer.

pseudo: water or ETOH glycerol green yellow red black coffee creamer
vodka
gin
rum
vermouth
tequila
grapefruit juice (√)
orange juice
sour mix 60% (√)
ouzo 40%
triple-sec 20%
red wine √√
cola √√

0.3 Arabidopsis anatomy

Arabidopsis See planting schedule.

Grow Arabidopsis thaliana in individual little pots (about 2 seeds per pot), 2 pots per student pair, starting 7 weeks before class. Seems to work better with dry seeds. Thin them if necessary, so there are individual plants to examine.

Grow a few seeds on MS medium, one plate per student pair. Put into refrigerator about 1 week before class, into growth chamber about 5 days before class

Make enough MS plates for Lab 3.3. Use extra for demo.

MS medium:

To make MS agar plates (100 mm)
you'll need: mL water total
start with: mL water
add: mL MS 10X macronutrients
add: mL MS 10X micronutrients
add: g MES, adjust pH to 5.7 with KOH, bring to final volume
add: g agar
autoclave: minutes

leave stir bar in

put bottles on stir plate near sterile hood until handle-able

To make: 500 mL 750 mL 1 L
~300 ~450 ~600 mL ddH2O*
50 75 100mL 10X MS Macronutrients
50 75 100mL 10X MS Macronutrients
0.25 0.375 0.5g MES
pH to 5.7 ~15 ~540µL ~33 drops KOH
Bring to volume with ddH2O |
5 10 g Bacto- or phyto-agar
autoclave
Pour 30 mL/plate in hood 16 25 33 plates

*without water, the nutrients precipitate

Buy vegetables at the grocery store, enough for one complete set/pair or pair of pairs. At home, sort out the necessary amounts, then keep the rest.

spinach – whole plant if possible broccoli (with yellow showing)
green bean in pods carrots
peas in pods, loose peas zucchini
beans edamame is good; should be able to see the beginning of hypocotyl lettuce – romaine is good. Remove outer leaves (and keep at home for salads), so students can dissect down to the meristem
sesame seeds tomato
-celery (peel back until it’s obviously a petiole) corn
bean sprouts pepper

Dissecting Scopes

✮Clean-up:✮

Put plant debris and used potting soil in the bucket labeled “Compost”. Add something about putting away dissecting microscopes

AttachmentSize
images.jpg4.91 KB
revised_lab0-3.docx11.61 MB

Arabidopsis pix

AttachmentSize
cotyledons1.jpg96.84 KB
cotyledons2.jpg52.11 KB
cotyledons3.jpg54.74 KB
cotyledons4.jpg90.67 KB
cotyledons5.jpg49.62 KB
cotyledons6.jpg152.55 KB
hypocotyl_1.jpg66.98 KB
hypocotyl_2.jpg68.71 KB
hypocotyl_3.jpg51.5 KB
seedlingroots7.jpg34.88 KB
seedlingroots8.jpg124.85 KB
seedlingroots9.jpg116.16 KB
seedlingroots10.jpg105.12 KB
seedlingroots11.jpg104.39 KB
seedlingroots12.jpg166.16 KB
seedlingroots13.jpg123.53 KB
seedlingroots14.jpg122.71 KB

1.1 DNA extraction

Wednesday 1/25/2012

Equipment for 1.1

  • Water bath at 65C
  • Mortar & pestle
  • Dry bath at 65C
  • Centrifuge at 4C
  • 14 mL round bottom POLYPROPYLENE tubes with snap cap. (Becton Dickinson #352059: Fisher 14-959-11B stockroom item)
  • Paper & scotch tape
  • Miracloth (EMD_BIO-475855) & funnels
  • 4-8 pots of densely sown Arabidopsis 1 per pair
  • Medium weighboat for chopped up leaves
  • Paper diaper for bench
  • Liquid N2 + extra ice buckets
  • Stinky waste bucket in hood

Reagents for 1.1

Extracting genomic DNA from Arabidopsis thaliana

For pairs of students
make: aliquots of exactly 6 mL DEB in round-bottom tubes
make: 1 mL aliquots of T10E1
make: 1 mL aliquots of T10E5
make: 1.5 mL aliquots of EtOH 95%
make: 5 mL aliquots of EtOH 70
make: exactly 6 mL aliquots of isopropanol in round bottom tubes
make: 4 mL aliquots of KOAc 5M
make: 100 uL aliquots of NaOAc

Ingredient per pair per class
DEB exactly 6 mL in round-bottomed tube 100 mL
add 5 µL BME per tube at the last minute
T10E1 1 mL 4 mL/pair/semester. Make 100 1mL aliquots
T10E5 1 mL 15 mL
EtOH 95% 1.5 mL 50 mL
EtOH 70% 5 mL 100 mL
ISOprop exactly 6 mL in round-bottom tube 100 mL
KOAc 5M 4 mL 50 mL
NaOAc 3M pH 5.2 100 µL 5 mL

1.2 DNA Quantification

Goal for this lab:

Quantify Arabidopsis DNA by two methods. (It is hard to finish all the analysis in 3 hours – better if this happens on a Monday 4 hour lab. Otherwise save the gel analysis till the next period, along with the Wiki.)

For pairs of students
make: 1 mL aliquots DB (10 mM Tris pH 7.5) or T10E1
make: 100 µL aliquots 6X loading dye
make: 25 µL aliquots MassRuler High Range

6X Loading dye to be used throughout the semester: 100 µL

MassRuler™ DNA Ladder, High Range Fermentas #SM0393 Give them 25µL in a microfuge tube

Materials for DNA quant

EQUIPMENT

  • Turn on the spectrophotometers
  • Cut and distribute diaper pads
  • Make EtBr waste containers
  • Diapered area (to catch ethidium bromide drips)
  • sterile
    • microfuge tubes
    • tips
  • paper towels for handling gels
  • Cuvettes
    • Krackeler 478-759220 pack of 100ultra micro cuvettes, 15 mm window ht, Brand UV $71 list price
    • Fisher 13-878-123 BRAND* UV-Cuvette Disposable Cuvets from BrandTech* Ultramicro; 15mm window; 100/Pk $49.66 available at stockroom

Reading should be below 0.3 to stay in linear range. See graph showing loss of linearity for fluorescein (in 1M NaOH) absorbance in Jenova spec above Abs=0.3

2.1 - 2.3 Gene maps

2.1 Initial Working Maps of Unknown Genes 2/02/11

For 2013, order

2.2 Finalizing Gene Models 2/07/11

2.3 Choosing PCR Primers 2/09/11

Put primer choosing doc on website Make sure it includes primer names and sequences.

List of available restriction enzymes:

AatII
Acc65I
AclI
AflII
AgeI
ApaLI
AscI
AvaI
AvaII
BamHI
BglII
BspDI
BspEI
ClaI
EagI
EcoRI
EcoRV
FseI1
HaeIII
HhaI
HindIII
HinP1I
HpaI
HpaII
KasI
MboI
MluI
MspI
NaeI
NcoI
NdeI
NheI
PvuI
PvuII
RsaI
SacI
SacII
SalI
Sau3AI
ScaI
SpeI
SphI
StyI
XbaI
XhoI
XmaI


  1. keep at -80C 

AttachmentSize
primer_choosing_worksheet.doc23 KB

2.4 Testing PCR

Aliquot enough for each pair, plus 2

Materials:

Taq

Make 2 tubes, so both instructors can carry them around in the freezer box

Waterbath at 65C

Gels (1.5%)

AttachmentSize
dorfmanumassbio383hprimers-1.xlsx43.77 KB
383h-tuth-2015f.xls23.5 KB

2.5 Restriction Mapping

W 2/22/12

Goal for this lab: Purify the amplified DNA from first lab, digest it with restriction enzymes, and assess the results with gel electrophoresis.

Zymo Research DNA Clean & Concentrator-5 Cat # T1225 K

$69 for kit of 50

Reagents Per Pair:


Restriction Enzymes for 2012

Grp enz 1 enz 2 NEB buffer
ASP Xho1 Hind3 2
BLW EcoRV Cla1 3, 4, (2)
CHC Bgl2 Cla1 3, 4
CNT pvu1 EcoRV 3
EFO Hpa1 Mlu1 4, 3
KSY Spe1 Sph1 2
LSO Sal1 EcoRV 3
NOD EcoRV Sac1 1, 2, 3, 4
RFR Cla1 Hind3 4,2,
RMT Bgl2 Pvu2 3

Bgl2 Cla1 EcoRV Hind3 Hpa1 Mlu1 pvu1 Pvu2 Sac1 Sal1 Spe1 Sph1 Xho1


Equipment

AttachmentSize
semi-log_paper.doc90.5 KB
2-cycle_semi-log.pdf24.72 KB

2014 RE

MW TuTh buf1 buf 2 buf 3 buf 4 cutsmart
AatII Aat II 0 50 50 100 100
AclI AclI 100
AflII AflII 50 100 25 100 100
BciVI 100
Bgl2 10 75 100 10 10
BmgBI 3.1-100 10
BspE1 0 10 100 0 10
BsrBI 100
BsrGI 25
ClaI 10 50 50 100 100
DraI 100
EarI 100
EcoRI 100 100 100 100 50
EcoRV 50 75 100 50 10
HindIII HindIII 50 100 10 50 50
HpaI 25 50 10 100 100
MluI 25 75 100 50 25
NcoI 100 100 100 100 100
Pvu2 100 100 100 100 100
SexAI 100
SpeI 75 100 25 75 100
XbaI 0 100 75 75 100

2017 schedule

AttachmentSize
draft_laboratory_schedule_2017.docx118.35 KB

3.2 Planting Salk seeds

3.1 Identifying T-DNA insertion sites 2/28/13

ORDER PRIMERS

Need homozygous strains for low iron testing. Indicated by Salk ________c

K Dorfman SALK-LB195
TCGGAACCACCATCAAACGGATT

K Dorfman SALK-LB205
CATCAAACAGGATTTTCGCCTGCT

LBb1.3 ATTTTGCCGATTTCGGAAC 110 bp from left border http://signal.salk.edu/tdnaprimers.2.html

3.2 Salk line genetics 3/4/13

Plant seeds of SALK lines and prepare to analyze the plants that will grow from them.

Prepare pots for students. 4 pots of soil per pair (plus extras), already treated with Gnatrol by Teddi

Imbibe seeds for students.
Per pair:

3.3 Salk phenotypes

M 3/5/12

Per Pair:

Total plates (actually need 20 of each type)

AttachmentSize
salt-germination-10.xlsx147.71 KB

MS plates

Murashige & Skoog Medium

30 mL per plate

Use the tall petri plates so the seedlings have more space

MS complete

ingredient 750 800 1000 1200 1600 mL
number of plates 25 27 33 40 53
ddH2O* 450 480 600 720 960 mL
10X macronutrients 1 75 80 100 120 160 mL
10X micronutrients 2 75 80 100 120 160 mL
MES 0.375 0.4 0.5 0.6 0.8 g

*Add the other salt mixtures to the water to prevent precipitation

pH to 5.7 with 1M KOH (initial pH = ~3.66) (needs ~720 µL/L)

Bring to volume with distilled water

ingredient 750 800 1000 1200 1600 mL
bacto or phyto agar 7.5 8 10 12 16 g

autoclave with stir bar in flask or bottle

Stir until cool enough to handle

Pour 30 mL per plate (use the deep ones)


  1. Sigma M 0654 Murashige and Skoog basal salt macronutrient solution (Krackeler 45-M0654-1L-EA) ~$26 

  2. Sigma M 0529 Murashige and Skoog basal salt micronutrient solution (Krackeler 45-M0529-1L-EA) ~$26 

MS nutrients

MS macronutrients 10X

Sigma M 0654

Component mg/L
Potassium phosphate monobasic 170
Magnesium sulfate 180.7
Calcium chloride anhydrous 332.2
Ammonium nitrate 1650
Potassium nitrate 1900

MS micronutrients 10X

Sigma M 0529

Component mg/L
Boric acid 6.2
Cobalt chloride . 6H2O 0.025
Cupric sulfate. 5H2O 0.025
Ferrous sulfate.7H2O 27.8
Manganese sulfate. H2O 16.9
Molybdic acid (sodium salt) o 2H2O 0.25
Na2-EDTA 37.3
Potassium iodide 0.83
Zinc sulfate.7H2O 8.6

MS low iron

**Murashige & Skoog 1µM iron medium

MS 10x micronutrients is 100 µM FeSO4, so MS complete is 10 µM

FeSO4 stock is 10 mM, which is 10,000x 1 µM

To make plates low-iron MS
start with mL ddH2O (~ 60% final volume)
add: mL 10X macronutrients
add: mL boric acid 1000X
add: mL cobalt chloride 10,000X
add: mL cupric sulfate 10,000X
add: mL ferrous sulfate 10 mM
add: mL KI 10,000X
add: mL manganese sulfate 1000X
add: mL moybdic acid 10,000X
add: mL zinc sulfate 1000X
add: g MES, pH to 5.7 with KOH
bring to mL final volume
add: g bacto- or phyto-agar
autoclave for minutes

ingredient 750 1000 1200 1500 mL
number of plates 25 33 40 50
ddH2O* 450 600 600 960 mL
10X macronutrients 75 100 120 150 mL
boric acid 1000x 0.75 1.0 1.2 1.5 mL
Cobalt chloride 10,000x 0.075 0.1 0.12 0.15 mL
cupric sulfate 10,000x 0.075 0.1 0.12 0.15 mL
ferrous sulfate 10,000x 0.075 0.1 0.12 0.15 mL
KI 10,000x 0.075 0.1 0.12 0.15 mL
manganese sulfate 1000x 0.75 1.0 1.2 1.5 mL
molybdic acid 10,000x x 0.075 0.1 0.12 0.15 mL
zinc sulfate 1000x 0.75 1.0 1.2 1.5 mL
MES 0.375 0.5 0.6 0.75 g

*Add the other salt mixtures to the water to prevent precipitation

pH to 5.7 with 1M KOH (initial pH = ~4.6) (needs ~570 drops/L)

Bring to volume with distilled water

ingredient 750 1000 1200 1500 mL
bacto or phyto agar 7.5 10 12 15 g

autoclave with stir bar in flask or bottle

Stir until cool enough to handle

Pour 30 mL per plate (use the deep ones)

3.4 Leaf Squish & PCR

Salk genotyping: Leaf Squish & PCR

See revised instructions handout below.

CORRECT PCR CALCS IN HANDOUT

correct PCR cycle. should be

Goal for this lab: Genotype Salk line plants, looking for homozygous mutants.

the RP is always on the side of the flanking sequence, that is, RP is always on the 3' end of the insertion. Therefore, the PCR reaction should always be set up as LB+RP for HM and LP+RP for WT. http://signal.salk.edu/tdnaprimers.2.html

Use 3 primers in a single reaction (GSP1, GSP2, LBP) OR

Run 2 separate gels

LB 195

LBb1.3 ATTTTGCCGATTTCGGAAC (111 bp from left border)

Should be on a long-lab day! If it can't be on the long day, it should stop at DNA extraction, then do PCR plus gel the next period!

Set out the 24-tube microcentrifuges. They have 13 samples.

Materials

(See materials for Lab 1.1)

ingredient mL per rxn x 26 rxn x 19 pairs
DEB 0.6 15.6 296.4
KOAc 0.25 6.5 123.5
Isoprop 0.6 15.6 296.4
70% EtOH 1.4 36.4 691.6
T10E5 0.225 5.85 111.15
NaOAc 0.025 0.65 12.35
100%EtOH 0.5 13 247
T10E1 0.05 1.3 24.7

Put out 3 double block dry baths at 65C

AttachmentSize
salkprimerlabels2013.doc59 KB
lab3-4-redo.docx208.99 KB
lab_3-4-leafsquish.docx138.66 KB
2015-phire-genotyping.docx172.64 KB

3.4 - Phire Plant kit

Phire Plant Direct PCR Kit

Fisher F-130WH

Per plant sample:

  • 20 uL Dilution Buffer

Per 20 uL reaction:

  • 10 uL 2X Phire Plant PCR buffer
  • (primers to 0.5 uM)
  • 0.4 uL Phire hot start polymerase
  • 0.5 uL Plant squish supernate
  • sterile water to make 20 uL

Lab 3.4 2012

M 3/26/12

CORRECT THE VOLUMES IN THE LAB MANUAL 21 mL 10X in 210 mL total!

Goal for this lab: Genotype Salk line plants, looking for homozygous mutants.

Use 3 primers in a single reaction (GSP1, GSP2, LBP)

LB 195 LBb1.3 ATTTTGCCGATTTCGGAAC (111 bp from left border)

Materials

  • PCR strip tubes
  • Harris cutting mat
  • Harris Uni-Core (0.5 mm) Cutting Tool
  • Beakers for bleach

Reagents

  • 2% bleach (12 mL bleach + 588 mL dH2O)
  • 5U/µL Taq (3.5 µL per pair)
  • 10X polymerase buffer (21 + 21 = 42 µL per pair)
  • 2.5 mM dNTP mix (51 µL per pair)
  • Sterile dH2O
  • Working stocks of primers, including LBP diluted to 10 µM (17µL/rxn)

leaf squish calcs

Forrxns/pair, & pairs
aliquotmL DEB /pair, & mL total
aliquotmL KOAc/pair, & mL total
aliquotmL isopropyl/pair, & mL total
aliquotmL 70% EtOH/pair, & mL total
aliquotmL T10E5/pair, & mL total
aliquotmL NaOAc/pair, & mL total
aliquotmL 100% EtOH/pair, & mL total
aliquotmL T10E1/pair, & mL total

AttachmentSize
leaf_squish_calcs.txt3.02 KB

3.5 Salk genotypes

Identifying genotypes of Salk-line plants: Analysis

Goal for this lab: Determine the genotypes of Salk line plants to identify homozygous mutant individuals. Run PCR reactions from 3.4 on gels

Students will have 28 + samples, so they need two gels.

Materials:

4. Bioinformatics

4.1 Basic Local Alignment Tool (BLAST) W 3/07/12

4.2 Library Research M 3/12/12

4.3 Representing Sequence Similarity Data W 3/14/12

5.1 - 5.3 expression

5.1 Microarray resources M 4/2/12

MAKE SURE GENEVESTIGATOR ACCOUNT IS ACTIVE!!

5.2 Statistical analysis of microarray data W 4/4/12

Tell students what chemicals are available

http://www.phytotechlab.com/searchresult.aspx?categoryid=10

http://www.plantmedia.com/categories/3_43_288_691/Tissue-Culture-Hormone...

paper on germination in salt: http://www.researchgate.net/publication/255710805_The_effect_of_salt_str...

5.3 RT-PCR Planning M 4/9/12

AttachmentSize
fisheruploadoligosfor_qpcr_2013_0.xls28.5 KB

2014 projects

RPR

4 MS plates plain
4 MS plates + final conc 140 mM NaCl


CTH

Salicylic acid in EtOH

Dilute into tween20 in water

Spray on plants


TVZ

Colloidal solution of chitin

mortar and pestle


CCM

Spray plants with Salicylic acid. see CTH.


MOH

damaged roots vs intact roots

plates


BHK

seeds

germination wet vs dry


WRD

light vs dark


NAL


CVM

KCl

5.4 RNA Extraction

2015

W 4/11/12

Prepare total RNA from selected Arabidopsis tissues and accurately quantify RNA concentration and yield.

Equipment:

Reagents

One tube for each group (2 per group of RPE), plus 5 to have on hand

Follow kit instructions for adding β-M-EtOH

1.0% agarose – enough for 12 groups + 2 accidents

HMW ladder. remove the LMW ladder from their boxes; replace with HMW (in Fermentas box in freezer)

Full carboy of 1X TAE

Remove anything that might be contaminated with RNAse, e.g.

Order the DNase separately. Qiagen 79254.

The kit comes with RNase-free water and RDD for diluting the DNAse

To program the Spectrophotometer:

Save RNA samples in the -80!


  1. Disposable Pellet Pestle without microtubes; 1.5mL K749521-1500 Kimble Chase Kontes Case of 100 for $54.74 

  2. RNeasy Plant Mini Kit (50) Qiagen 74904 

  3. DNase I Qiagen 79254 http://www.qiagen.com/products/accessories/rnase-freednaseset.aspx
    Inject 550µL RNAse-free water into the DNAse vial. Make 10 µL aliquots. Need ~48 labels. Freeze. Give away the excess. Can extend slightly by adding 575 µL to get 57 aliquots per vial instead of 55. 

5.5 RT-PCR

Prepare cDNA, and use it as a template for RT-PCR.

4 RT reactions: For each RNA sample (two tissues or two conditions): one +RT and one RT

2015

Equipment

RT Reagents

µL per group reagent actual need (µL) 15 aliquots (µL) notes
8 Oligo dT 50 µM 1 1 x 4 120
8 10 mM dNTP mix 2 1 X 4 120
60 RNAse-free water 13 x 4 900 aliquot once for both RT and qPCR
20 5X 1st strand buffer 4 x 4 300 comes with Superscript
8 0.1M DTT 1 x 4 120 comes with Superscript
(4 ) RNaseOUT 3 1 x 4 60 Dispensed from freezer box during lab
(2 ) superscript III 4 1 x 2, 30 dispensed from freezer box during lab

PCR Reagents

1 tube per group + 5 extra (except Taq and primers) dispense per group actual need

µL per group reagent actual need (µL) 15 aliquots (µL) notes
550 Sterile ddH2O 360 8250
75 10× Ex-Taq Buffer 50 1275
50 2.5 mM dNTP Mix 40 850
15 GSP1 12.5 μM 10 check their supply (or ask at the beginning of class)
15 GSP2 12.5 μM 10 check their supply (or ask at the beginning of class)
2 cDNA +/- Fe, each 2 30 dispense during lab
10 Ex-Taq Polymerase 1U/μL 10 150 dispensed during lab - can dilute to 0.8U/µL

  1. Fisher FERSO131 Oligo dT 100 µM (=0.5µg/µL) 60 µL @ ~$50. Dilute to 50µM!! (for emergencies: 50 µM oligo(dT) Fisher stockroom: C1101 0.5µg/µL x 40µL = 20µg) - Order T(18) from Invitrogen??? 

  2. 14 µL each + 84 µL RNase-free water OR Fisher FERR0192 

  3. Invitrogen 10777019 RNAse out 5KU @ $143 

  4. superscript III 200U/µL Invitrogen 18080044 10KU @ $259 

AttachmentSize
rnase_out.pdf71.72 KB
superscriptiii_man.pdf254.7 KB

RT calcs

Forpairs andreactions per pair
Reagent rxn volume aliquot volume total volume

5.6 RT-PCR analysis

Make enough for 2 gels/pair 1.5% agarose

gels mL TAE g agarose µL EtBr
11 550 8.25 5.5
20 1000 15 10
22 1100 16.5 11
24 1200 18 12

Use EtBr TAE

Use LMW mass ruler

5.6 qPCR

Q-PCR after RT

Housekeeping gene:

Gene At5g25760 (Ubiquitin Congugating enzyme 21) UBC21

Forward primer TCTCTCTCTCTCTCTCTCGCTCTC Reverse Primer TGATGCCTGCATCTCTAATTTCCC

Re-think the need to have exactly the same amount of RNA in each cDNA reaction.

Set up reactions in ISB. Use Qiagen 204054

Load reactions and take to Sam's lab.

Eppendorf Realplex2 Master Cycler

Reaction set up

component µL/rxn aliquot for 16 rxns
2x quantifast SYBR Green PCR master mix 10 176
qPCR forward primer 10 µM 1 32
qPCR reverse primer 10 µM 1 32
Template cDNA 1 -
RNAse free water 7 (use H2O from RT)
------------------------------------------------ ---- -----
Total 20

qPCR Settings

File - New Assay

plate layout:

Filter: SYBR

Sample volume: 20

Probe: SYBR

Filter: N/A

Background: spec background

Highlight the wells you want to detect. Label as unknowns.

PCR Program:

Step Temp Time
PCR initial heat activation 95 2 min
Denaturation 95 15 sec
Primer annealing 55 15 sec
Extension 68 20 sec

Save the assay.

Press run (green arrow icon).

Plates: USA Scientific 1402-9500

Sealing film: 2921-0010

AttachmentSize
qpcr-primer-labels-2013.doc82.5 KB
qpcr2013.docx67.18 KB
ct_values_from_qpcr_experiments-gg_2014tuth.docx29.58 KB
gg_mw_qpcr-1.xls31 KB
2015_tuth_qpcr_results.xlsx25.04 KB
gga_mw_s2015qpcr.xlsx14.14 KB
sandra_ubi_1_12_nov30_2015.xls30 KB

PCR Calcs

From Takara Ex Taq recipe

For 1µL PCR rxn. For PCR rxns
aliquotµL 10X Ex Taq buffer µL total
aliquotµL dNTP 2.5mM µL total
aliquotµL primer 1 12.5 µM µL total
aliquotµL primer 2 12.5 µM µL total
aliquotµL template DNA (~250 ng/µL) µL total
addµL water to final volume µL total
aliquotµL Ex Taq 1U/µL µL total

AttachmentSize
pcrcalcs.xls27.5 KB

Readings & on-line resources

Molecular Genetics information

Cold Spring Harbor DNA Learning Center

DNA from the Beginning

The New Genetics (on-line text)

NCBI Handbook glossary

GeneReviews Illustrated Glossary

qPCR

PCR

Human Molecular Genetics, 2nd ed

Sequence - Evolution- Function (2003)

Gene Ed (NLM NIH)

Gene Ed Biotechnology

Brown (2002) Studying the transcriptome

Brown (2002): genomes, transcriptomes and proteomes

Brown (2002) Understanding a Genome Sequence

Brown (2002) Studying DNA

Brown (2002) Nucleases

Brown (2002) DNA microarrays and chips

Arabidopsis specific material

"About Arabidopsis" at TAIR

The Arabidopsis Book - open access journal at TAIR

T-DNA as an insertional mutagen in Arabidopsis

link title

link title

link title

link title

link title

link title

link title