pL440 plasmid

these are the sequencing primers for the pL4440 plasmid

forward: CCTTTGAGTGAGCTGATACC

reverse: TTAAGTTGGGTAACGCCAGG

he said 1ul per 25ul sequencing reaction....