Drosophila

Drosophila kdorfman Wed, 01/04/2012 - 17:09

Drosophila culturing

Craig Woodard estimates they use 50 bottles and about 800 vials for 100 students for their drosophila mapping lab.

http://flystocks.bio.indiana.edu/Fly_Work/supplies.htm

http://flystocks.bio.indiana.edu/Fly_Work/culturing.htm

FOOD

Carolina 4-24 no-cook ready mix: 173204

4 4-L bags for ~$80

1 L makes 85 vials = 1360 vials @ ~$0.06


VIALS

standard size is "narrow" 25 x 95 mm

  • K-Resin and polypropylene vials are virtually unbreakable, scratch and mar resistant;
  • polystyrene and K-Resin vials have glass-like clarity
  • Polypropylene vials are autoclavable; polystyrene and K-Resin are nonautoclavable

Fisher:

Applied Scientific Drosophila Products Shell Vials

K-resin bulk packed 500 @ ~$92 ($0.18 each)

racked 500 @ ~$113 ($0.23 each)

flystuff

http://www.flystuff.com/vials.php

Register with Genesee Scientific

K-resin bulk packed 500: $96

tritech

http://www.tritechresearch.com/T3808.html

K-Resin narrow diam. vial (500/cs) - tray

$60.54 + $19 to ship! (=$80)

$49.73 † - 4 or more.

http://www.tritechresearch.com/T3809.html

T3809

K-Resin narrow diam. vial (500/cs) - bulk

$54.05 † - Regular price.

$43.24 † - 4 or more.

Dot Scientific

https://www.dotscientific.com/disposable.asp?scat=167

DP-9508 K-Resin narrow vial 500/CA : $60

  • $5 handling

Bloomington acct

Bloomington acct kdorfman Thu, 01/12/2012 - 16:17

Apparently lost account info from 12/30/11. Re-entered 1/12/12

http://fly.bio.indiana.edu/bloomhome.htm

Your Message Has Been Sent Below is what you submitted on Thursday, January 12, 2012 at 10:54:27


Purpose: Teaching

Organization Type: Higher Education Teaching

Organization Name: University of Massachusetts, Amherst

Website: http://www.bio.umass.edu/biology/

Account Type: APSingle

Honorific: Dr.

Account Holder First Name: Katherine

Account Holder Last Name: Dorfman

Mailing Address for Shipments: Katherine Dorfman 661 N Pleasant St ISB 241C University of Massachusetts Amherst, MA 01003

Import Permit: No

DNA extract

DNA extract kdorfman Mon, 03/12/2012 - 15:12

Isolating, digest out the P-element, Ligate P-element line DNA

Use Qiagen DNeasy Blood & Tissue Kit 69504 $141.12 for 50 reactions

LiCl/KAc

LiCl/KAc kdorfman Mon, 03/12/2012 - 18:01

LiCl/KAc

1 part 5M KAc : 2.5 parts 6M LiCl

Stock solution 14 17.5 21 mL final volume
5M KAc 4 5 6 mL
6M LiCl 10 12.5 15 mL

Ligase

Ligase kdorfman Mon, 03/12/2012 - 18:03

T4 DNA Ligase

NEB M0202S

Get from New England Biolabs Freezer Program in Fernald

Store in freezer

Comes with 10X ligase buffer (includes ATP

NaOAc

NaOAc kdorfman Mon, 03/12/2012 - 18:06

3M NaOAc

PBS for DNA

PBS for DNA kdorfman Mon, 03/12/2012 - 18:04

PBS

~200 mL/prep

4 preps per group

Aliquot 1 mL per group

Soution A

Soution A kdorfman Mon, 03/12/2012 - 18:00

Solution A

100 mM Tris-HCl pH 7.5

100mM EDTA

100 mM NaCl

0.5% SDS

Stock solution 10 25 50 100 mL final volume
1 M Tris 1 2.5 5 10 mL
0.5 M EDTA 2 5 10 20 mL
5 M NaCl 0.02 0.05 0.1 0.2 mL
20% SDS 0.25 0.625 1.25 2.5 mL

Make 10 mL

pH to 7.5

Gel Extraction

Gel Extraction kdorfman Mon, 04/02/2012 - 18:57

Extraction prep

Extraction prep kdorfman Mon, 04/02/2012 - 19:05

Equipment

  • razor blades
  • transilluminators
  • face shields
  • cutting boards
  • dry bath at 50C
  • columns & collection tubes

Solutions

  • Add ethanol to Buffer PE
  • Buffer QG ~2 mL (steps 4 & 8)
  • isopropyl - ~0.5 mL
  • NaOAc 3M, pH 5.0 ~25 µL
  • Buffer PE ~ 1.75 mL
  • Buffer EB ~ 75 µL (=Tris-Cl 10 mM pH 8.5)
  • 6x loading dye
  • 6 gels 1.5% (= 300 mL TAE + 4.5 g agarose + 3 µL EtBr)

protocol

protocol kdorfman Mon, 04/02/2012 - 19:08

QIAquick Gel Extraction Kit

(cat. nos. 28704 and 28706) store at room temperature (15°–25°C) for a year

www.qiagen.com/handbooks.

Notes before starting

  • The yellow color of Buffer QG indicates a pH7.5.
  • Add ethanol (96%–100%) to Buffer PE before use (see bottle label for volume).
  • Isopropanol (100%)
  • heating block or water bath at 50°C
  • All centrifugation steps are carried out at 17,900 x g (13,000 rpm) in a microcentrifuge.

Protocol

  1. Excise the DNA fragment from the agarose gel with a clean, sharp scalpel.
  2. Weigh the gel slice in a colorless tube. Add 3 volumes Buffer QG to 1 volume gel (100 mg ~ 100 µL). (For >2% agarose gels, add 6 volumes Buffer QG.)

  3. Incubate at 50°C for 10 min (or until the gel slice has completely dissolved). Vortex the tube every 2–3 min to help dissolve gel.

  4. After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose). If the color of the mixture is orange or violet, add 10 µL 3 M sodium acetate, pH 5.0, and mix. The color of the mixture will turn yellow.
  5. Add 1 gel volume of isopropanol to the sample and mix.
  6. Place a QIAquick spin column in a provided 2 mL collection tube or into a vacuum manifold.
  7. To bind DNA, apply the sample to the QIAquick column and centrifuge for 1 min or apply vacuum to the manifold until all the samples have passed through the column. Discard flow-through and place the QIAquick column back into the same tube. For sample volumes of >800µL, load and spin/apply vacuum again.

  8. If the DNA will subsequently be used for sequencing, in vitro transcription, or microinjection, add 0.5 mL Buffer QG to the QIAquick column and centrifuge for 1 min or apply vacuum. Discard flow-through and place the QIAquick column back into the same tube.

  9. To wash, add 0.75 mL Buffer PE to QIAquick column and centrifuge for 1 min or apply vacuum. Discard flow-through and place the QIAquick column back into the same tube. Note: If the DNA will be used for salt-sensitive applications (e.g., sequencing, blunt-ended ligation), let the column stand 2-5 min after addition of Buffer PE.

  10. Centrifuge the QIAquick column once more in the provided 2 mL collection tube for 1 min at 17,900g (13,000 rpm) to remove residual wash buffer.

  11. Place QIAquick column into a clean 1.5 mL microcentrifuge tube.
  12. To elute DNA, add 50 µL Buffer EB (10 mM Tris·Cl, pH 8.5) or water to the center of the QIAquick membrane and centrifuge the column for 1 min. For increased DNA concentration, add 30 µL Buffer EB to the center of the QIAquick membrane, let the column stand for 1 min, and then centrifuge for 1 min. After the addition of Buffer EB to the QIAquick membrane, increasing the incubation time to up to 4 min can increase the yield of purified DNA.
  13. If the purified DNA is to be analyzed on a gel, add 1 volume of Loading Dye to 5 volumes of purified DNA. Mix the solution by pipetting up and down before loading the gel.

Genotyping

Genotyping kdorfman Mon, 03/26/2012 - 15:51
  • 10.0 ul Ligated genomic DNA (~1/15 fly)
  • 2.0 ul 2mM each dNTP
  • 1.0 ul 10uM forward primer,* Plac4*
  • 1.0 ul 10uM reverse primer, *Plac1 *
  • 5.0 ul 10X Taq buffer
  • 31.0 ul ddH20
  • 0.4 ul 2 units Taq

Perform thermal cycling for recovery of 5' flanking as follows:

Cycle Temp Time # cycles

94C 3 min 1

  • Denature 94C 30 sec
  • Anneal 60C 1 min 35
  • Extend 68C 2 min

72C 10 min 1 4C HOLD

PCR Reaction to amplify 3' Flanking Sequence

  • 10.0 ul Ligated genomic DNA (~1/15 fly)
  • 2.0 ul 2mM each dNTP
  • 1.0 ul 10uM forward primer, Pry4
  • 1.0 ul 10uM reverse primer, *Plw3-1 *
  • 5.0 ul 10X Taq buffer
  • 31.0 ul ddH20
  • 0.4 ul 2 units Taq

Perform thermal cycling for recovery of 5' flanking as follows:

Cycle Temp Time # cycles

94C 3 min 1

  • Denature 94C 30 sec
  • Anneal 55C 1 min 35
  • Extend 68C 2 min

72C 10 min 1 4C HOLD

Sequencing

Sequencing kdorfman Mon, 04/02/2012 - 17:50

Primers for the 5'

  • Splac2 25mer GAATTCACTGGCCGTCGTTTTACAA

  • Sp1 22mer ACACAACCTTTCCTCTCAACAA

Primers for the 3'

  • Spep1 19mer GACACTCAGAATACTATTC

  • Sp6 23mer TGACCACATCCAAACATCCTCTT

Melting Temps for sequencing primers

  • Splac2 60.1C

  • Sp1 50.6C

  • Sp6 54.9C

  • Spep1 44.8C

sequencing results

sequencing results kdorfman Tue, 04/10/2012 - 18:21

Get Ape (A Plasmid Editor) for Mac to read the sequences (if it isn't installed already)

http://biologylabs.utah.edu/jorgensen/wayned/ape/

Strains

Strains kdorfman Thu, 01/12/2012 - 16:45

Order from Bloomington

shipping schedule: http://flystocks.bio.indiana.edu/Distribution/shipping.htm

order form: http://flystocks.bio.indiana.edu/Distribution/Order/searchbun.html

P-element lines to map:

Stock # Name
12039 P{lacW}Cka[s1883]
12176 P{lacW}lace[k05305]
11118 P{lacW}geminin[k14019]
12304 P{lacW}wah[j2E5]
31996 P{lacW}Klc[59A]
12211 P{lacW}Idh[L3852]

Mapping stocks and controls:

Stock # Name
1882 w[*]; al[1] b[1] c[1] sp[1]/CyO, P{sevRas1.V12}FK1
462 w[1118]; h[1] kni[ri-1] e[s]
3605 w1118 control
1 Canton-s control